Human P2RY4/NRU/P2P ORF/cDNA clone-Lentivirus particle (NM_002565)

Cat. No.: vGMLP004267

Pre-made Human P2RY4/NRU/P2P Lentiviral expression plasmid for P2RY4 lentivirus packaging, P2RY4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to P2RY4/NRU products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004267 Human P2RY4 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004267
Gene Name P2RY4
Accession Number NM_002565
Gene ID 5030
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1098 bp
Gene Alias NRU,P2P,P2Y4,UNR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCAGTACAGAGTCCTCCCTGTTGAGATCCCTAGGCCTCAGCCCAGGTCCTGGCAGCAGTGAGGTGGAGCTGGACTGTTGGTTTGATGAGGATTTCAAGTTCATCCTGCTGCCTGTGAGCTATGCAGTTGTCTTTGTGCTGGGCTTGGGCCTTAACGCCCCAACCCTATGGCTCTTCATCTTCCGCCTCCGACCCTGGGATGCAACGGCCACCTACATGTTCCACCTGGCATTGTCAGACACCTTGTATGTGCTGTCGCTGCCCACCCTCATCTACTATTATGCAGCCCACAACCACTGGCCCTTTGGCACTGAGATCTGCAAGTTCGTCCGCTTTCTTTTCTATTGGAACCTCTACTGCAGTGTCCTTTTCCTCACCTGCATCAGCGTGCACCGCTACCTGGGCATCTGCCACCCACTTCGGGCACTACGCTGGGGCCGCCCTCGCCTCGCAGGCCTTCTCTGCCTGGCAGTTTGGTTGGTCGTAGCCGGCTGCCTCGTGCCCAACCTGTTCTTTGTCACAACCAGCAACAAAGGGACCACCGTCCTGTGCCATGACACCACTCGGCCTGAAGAGTTTGACCACTATGTGCACTTCAGCTCGGCGGTCATGGGGCTGCTCTTTGGCGTGCCCTGCCTGGTCACTCTTGTTTGCTATGGACTCATGGCTCGTCGCCTGTATCAGCCCTTGCCAGGCTCTGCACAGTCGTCTTCTCGCCTCCGCTCTCTCCGCACCATAGCTGTGGTGCTGACTGTCTTTGCTGTCTGCTTCGTGCCTTTCCACATCACCCGCACCATTTACTACCTGGCCAGGCTGTTGGAAGCTGACTGCCGAGTACTGAACATTGTCAACGTGGTCTATAAAGTGACTCGGCCCCTGGCCAGTGCCAACAGCTGCCTGGATCCTGTGCTCTACTTGCTCACTGGGGACAAATATCGACGTCAGCTCCGTCAGCTCTGTGGTGGTGGCAAGCCCCAGCCCCGCACGGCTGCCTCTTCCCTGGCACTAGTGTCCCTGCCTGAGGATAGCAGCTGCAGGTGGGCGGCCACCCCCCAGGACAGTAGCTGCTCTACTCCTAGGGCAGATAGATTGTAA
ORF Protein Sequence MASTESSLLRSLGLSPGPGSSEVELDCWFDEDFKFILLPVSYAVVFVLGLGLNAPTLWLFIFRLRPWDATATYMFHLALSDTLYVLSLPTLIYYYAAHNHWPFGTEICKFVRFLFYWNLYCSVLFLTCISVHRYLGICHPLRALRWGRPRLAGLLCLAVWLVVAGCLVPNLFFVTTSNKGTTVLCHDTTRPEEFDHYVHFSSAVMGLLFGVPCLVTLVCYGLMARRLYQPLPGSAQSSSRLRSLRTIAVVLTVFAVCFVPFHITRTIYYLARLLEADCRVLNIVNVVYKVTRPLASANSCLDPVLYLLTGDKYRRQLRQLCGGGKPQPRTAASSLALVSLPEDSSCRWAATPQDSSCSTPRADRL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T82083-Ab Anti-P2RY4/ NRU/ P2P monoclonal antibody
    Target Antigen GM-Tg-g-T82083-Ag P2RY4 VLP (virus-like particle)
    ORF Viral Vector pGMLP004267 Human P2RY4 Lentivirus plasmid
    ORF Viral Vector vGMLP004267 Human P2RY4 Lentivirus particle


    Target information

    Target ID GM-T82083
    Target Name P2RY4
    Gene ID 5030, 57385, 695127, 63843, 101087905, 100688008, 514653, 111771529
    Gene Symbol and Synonyms NRU,P2P,P2RY4,P2Y4,P2Y4R,UNR
    Uniprot Accession P51582
    Uniprot Entry Name P2RY4_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000186912
    Target Classification GPCR

    The product of this gene belongs to the family of G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor is responsive to uridine nucleotides, partially responsive to ATP, and not responsive to ADP. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.