Human PROCR/CCCA/CCD41 ORF/cDNA clone-Lentivirus plasmid (NM_006404)

Cat. No.: pGMLP004289
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PROCR/CCCA/CCD41 Lentiviral expression plasmid for PROCR lentivirus packaging, PROCR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to PROCR/CCCA products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $479.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004289
Gene Name PROCR
Accession Number NM_006404
Gene ID 10544
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 717 bp
Gene Alias CCCA,CCD41,EPCR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTTGACAACATTGCTGCCGATACTGCTGCTGTCTGGCTGGGCCTTTTGTAGCCAAGACGCCTCAGATGGCCTCCAAAGACTTCATATGCTCCAGATCTCCTACTTCCGCGACCCCTATCACGTGTGGTACCAGGGCAACGCGTCGCTGGGGGGACACCTAACGCACGTGCTGGAAGGCCCAGACACCAACACCACGATCATTCAGCTGCAGCCCTTGCAGGAGCCCGAGAGCTGGGCGCGCACGCAGAGTGGCCTGCAGTCCTACCTGCTCCAGTTCCACGGCCTCGTGCGCCTGGTGCACCAGGAGCGGACCTTGGCCTTTCCTCTGACCATCCGCTGCTTCCTGGGCTGTGAGCTGCCTCCCGAGGGCTCTAGAGCCCATGTCTTCTTCGAAGTGGCTGTGAATGGGAGCTCCTTTGTGAGTTTCCGGCCGGAGAGAGCCTTGTGGCAGGCAGACACCCAGGTCACCTCCGGAGTGGTCACCTTCACCCTGCAGCAGCTCAATGCCTACAACCGCACTCGGTATGAACTGCGGGAATTCCTGGAGGACACCTGTGTGCAGTATGTGCAGAAACATATTTCCGCGGAAAACACGAAAGGGAGCCAAACAAGCCGCTCCTACACTTCGCTGGTCCTGGGCGTCCTGGTGGGCAGTTTCATCATTGCTGGTGTGGCTGTAGGCATCTTCCTGTGCACAGGTGGACGGCGATGTTAA
ORF Protein Sequence MLTTLLPILLLSGWAFCSQDASDGLQRLHMLQISYFRDPYHVWYQGNASLGGHLTHVLEGPDTNTTIIQLQPLQEPESWARTQSGLQSYLLQFHGLVRLVHQERTLAFPLTIRCFLGCELPPEGSRAHVFFEVAVNGSSFVSFRPERALWQADTQVTSGVVTFTLQQLNAYNRTRYELREFLEDTCVQYVQKHISAENTKGSQTSRSYTSLVLGVLVGSFIIAGVAVGIFLCTGGRRC

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1406-Ab Anti-EPCR/ PROCR/ CCCA monoclonal antibody
    Target Antigen GM-Tg-g-MP1406-Ag PROCR VLP (virus-like particle)
    ORF Viral Vector pGMLP004289 Human PROCR Lentivirus plasmid
    ORF Viral Vector vGMLP004289 Human PROCR Lentivirus particle


    Target information

    Target ID GM-MP1406
    Target Name PROCR
    Gene ID 10544, 19124, 706040, 362248, 101082897, 485848, 282005, 100069445
    Gene Symbol and Synonyms CCCA,CCD41,EPCR,PROCR
    Uniprot Accession Q9UNN8
    Uniprot Entry Name EPCR_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000101000
    Target Classification Not Available

    The protein encoded by this gene is a receptor for activated protein C, a serine protease activated by and involved in the blood coagulation pathway. The encoded protein is an N-glycosylated type I membrane protein that enhances the activation of protein C. Mutations in this gene have been associated with venous thromboembolism and myocardial infarction, as well as with late fetal loss during pregnancy. The encoded protein may also play a role in malarial infection and has been associated with cancer. [provided by RefSeq, Jul 2013]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.