Human WNT5B ORF/cDNA clone-Lentivirus plasmid (NM_030775)
Pre-made Human WNT5B/ Lentiviral expression plasmid for WNT5B lentivirus packaging, WNT5B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to WNT5B/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP004360 | Human WNT5B Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP004360 |
Gene Name | WNT5B |
Accession Number | NM_030775 |
Gene ID | 81029 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1080 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCCCAGCCTGCTGCTGCTGTTCACGGCTGCTCTGCTGTCCAGCTGGGCTCAGCTTCTGACAGACGCCAACTCCTGGTGGTCATTAGCTTTGAACCCGGTGCAGAGACCCGAGATGTTTATCATCGGTGCCCAGCCCGTGTGCAGTCAGCTTCCCGGGCTCTCCCCTGGCCAGAGGAAGCTGTGCCAATTGTACCAGGAGCACATGGCCTACATAGGGGAGGGAGCCAAGACTGGCATCAAGGAATGCCAGCACCAGTTCCGGCAGCGGCGGTGGAATTGCAGCACAGCGGACAACGCATCTGTCTTTGGGAGAGTCATGCAGATAGGCAGCCGAGAGACCGCCTTCACCCACGCGGTGAGCGCCGCGGGCGTGGTCAACGCCATCAGCCGGGCCTGCCGCGAGGGCGAGCTCTCCACCTGCGGCTGCAGCCGGACGGCGCGGCCCAAGGACCTGCCCCGGGACTGGCTGTGGGGCGGCTGTGGGGACAACGTGGAGTACGGCTACCGCTTCGCCAAGGAGTTTGTGGATGCCCGGGAGCGAGAGAAGAACTTTGCCAAAGGATCAGAGGAGCAGGGCCGGGTGCTCATGAACCTGCAAAACAACGAGGCCGGTCGCAGGGCTGTGTATAAGATGGCAGACGTAGCCTGCAAATGCCACGGCGTCTCGGGGTCCTGCAGCCTCAAGACCTGCTGGCTGCAGCTGGCCGAGTTCCGCAAGGTCGGGGACCGGCTGAAGGAGAAGTACGACAGCGCGGCCGCCATGCGCGTCACCCGCAAGGGCCGGCTGGAGCTGGTCAACAGCCGCTTCACCCAGCCCACCCCGGAGGACCTGGTCTATGTGGACCCCAGCCCCGACTACTGCCTGCGCAACGAGAGCACGGGCTCCCTGGGCACGCAGGGCCGCCTCTGCAACAAGACCTCGGAGGGCATGGATGGCTGTGAGCTCATGTGCTGCGGGCGTGGCTACAACCAGTTCAAGAGCGTGCAGGTGGAGCGCTGCCACTGCAAGTTCCACTGGTGCTGCTTCGTCAGGTGTAAGAAGTGCACGGAGATCGTGGACCAGTACATCTGTAAATAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP1937-Ab | Anti-WNT5B monoclonal antibody |
Target Antigen | GM-Tg-g-MP1937-Ag | WNT5B VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-MP1937 | wingless-type MMTV integration site family, member 5B (WNT5B) protein & antibody |
ORF Viral Vector | pGMLP004360 | Human WNT5B Lentivirus plasmid |
ORF Viral Vector | vGMLP004360 | Human WNT5B Lentivirus particle |
Target information
Target ID | GM-MP1937 |
Target Name | WNT5B |
Gene ID | 81029, 22419, 721685, 282582, 101085809, 486756, 508008, 100056017 |
Gene Symbol and Synonyms | Wnt-5b,WNT5B |
Uniprot Accession | Q9H1J7 |
Uniprot Entry Name | WNT5B_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000111186 |
Target Classification | Not Available |
The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 94% and 80% amino acid identity to the mouse Wnt5b protein and the human WNT5A protein, respectively. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.