Human OPALIN/HTMP10/TMEM10 ORF/cDNA clone-Lentivirus plasmid (NM_033207)

Cat. No.: pGMLP004392
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human OPALIN/HTMP10/TMEM10 Lentiviral expression plasmid for OPALIN lentivirus packaging, OPALIN lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to OPALIN/HTMP10 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004392
Gene Name OPALIN
Accession Number NM_033207
Gene ID 93377
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 426 bp
Gene Alias HTMP10,TMEM10,TMP10
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGTTTTTCACTGAACTTCACCCTGCCGGCGAACACAACGTCCTCTCCTGTCACAGGTGGGAAAGAAACGGACTGTGGGCCCTCTCTTGGATTAGCGGCGGGCATACCATTGCTGGTGGCCACAGCCCTGCTGGTGGCTTTACTATTTACTTTGATTCACCGAAGAAGAAGCAGCATTGAGGCCATGGAGGAAAGTGACAGACCATGTGAAATTTCAGAAATTGATGACAATCCCAAGATATCTGAGAATCCTAGGAGATCACCCACACATGAGAAGAATACGATGGGAGCACAAGAGGCCCACATATATGTGAAGACTGTAGCAGGAAGCGAGGAACCTGTGCATGACCGTTACCGTCCTACTATAGAAATGGAAAGAAGGAGGGGATTGTGGTGGCTTGTGCCCAGACTGAGCCTGGAATGA
ORF Protein Sequence MSFSLNFTLPANTTSSPVTGGKETDCGPSLGLAAGIPLLVATALLVALLFTLIHRRRSSIEAMEESDRPCEISEIDDNPKISENPRRSPTHEKNTMGAQEAHIYVKTVAGSEEPVHDRYRPTIEMERRRGLWWLVPRLSLE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0919-Ab Anti-OPALI/ OPALIN/ HTMP10 monoclonal antibody
    Target Antigen GM-Tg-g-MP0919-Ag OPALIN VLP (virus-like particle)
    ORF Viral Vector pGMLP004392 Human OPALIN Lentivirus plasmid
    ORF Viral Vector vGMLP004392 Human OPALIN Lentivirus particle


    Target information

    Target ID GM-MP0919
    Target Name OPALIN
    Gene ID 93377, 226115, 704725, 361757, 101097350, 608634, 616443, 100630111
    Gene Symbol and Synonyms HTMP10,OPALIN,TMEM10,TMP10
    Uniprot Accession Q96PE5
    Uniprot Entry Name OPALI_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000197430
    Target Classification Not Available

    Predicted to be involved in regulation of oligodendrocyte differentiation. Located in Golgi apparatus. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.