Human IL17C/CX2/ IL-17C ORF/cDNA clone-Lentivirus plasmid (NM_013278)
Pre-made Human IL17C/CX2/ IL-17C Lentiviral expression plasmid for IL17C lentivirus packaging, IL17C lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to IL17C/CX2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP004492 | Human IL17C Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP004492 |
Gene Name | IL17C |
Accession Number | NM_013278 |
Gene ID | 27189 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 594 bp |
Gene Alias | CX2, IL-17C |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGACGCTCCTCCCCGGCCTCCTGTTTCTGACCTGGCTGCACACATGCCTGGCCCACCATGACCCCTCCCTCAGGGGGCACCCCCACAGTCACGGTACCCCACACTGCTACTCGGCTGAGGAACTGCCCCTCGGCCAGGCCCCCCCACACCTGCTGGCTCGAGGTGCCAAGTGGGGGCAGGCTTTGCCTGTAGCCCTGGTGTCCAGCCTGGAGGCAGCAAGCCACAGGGGGAGGCACGAGAGGCCCTCAGCTACGACCCAGTGCCCGGTGCTGCGGCCGGAGGAGGTGTTGGAGGCAGACACCCACCAGCGCTCCATCTCACCCTGGAGATACCGTGTGGACACGGATGAGGACCGCTATCCACAGAAGCTGGCCTTCGCCGAGTGCCTGTGCAGAGGCTGTATCGATGCACGGACGGGCCGCGAGACAGCTGCGCTCAACTCCGTGCGGCTGCTCCAGAGCCTGCTGGTGCTGCGCCGCCGGCCCTGCTCCCGCGACGGCTCGGGGCTCCCCACACCTGGGGCCTTTGCCTTCCACACCGAGTTCATCCACGTCCCCGTCGGCTGCACCTGCGTGCTGCCCCGTTCAGTGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1022-Ab | Anti-IL17C/ CX2/ IL-17C functional antibody |
Target Antigen | GM-Tg-g-SE1022-Ag | IL17C protein |
Cytokine | cks-Tg-g-GM-SE1022 | interleukin 17C (IL17C) protein & antibody |
ORF Viral Vector | pGMLP004492 | Human IL17C Lentivirus plasmid |
ORF Viral Vector | pGMLP-IL-022 | Human IL17C Lentivirus plasmid |
ORF Viral Vector | pGMAP-IL-105 | Human IL17C Adenovirus plasmid |
ORF Viral Vector | vGMLP004492 | Human IL17C Lentivirus particle |
ORF Viral Vector | vGMLP-IL-022 | Human IL17C Lentivirus particle |
ORF Viral Vector | vGMAP-IL-105 | Human IL17C Adenovirus particle |
Target information
Target ID | GM-SE1022 |
Target Name | IL17C |
Gene ID | 27189, 234836, 710618, 691516, 101097443, 608988, 100050766 |
Gene Symbol and Synonyms | CX2,IL-17C,IL17C |
Uniprot Accession | Q9P0M4 |
Uniprot Entry Name | IL17C_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000124391 |
Target Classification | Tumor-associated antigen (TAA) |
The protein encoded by this gene is a T cell-derived cytokine that shares the sequence similarity with IL17. This cytokine was reported to stimulate the release of tumor necrosis factor alpha and interleukin 1 beta from a monocytic cell line. The expression of this cytokine was found to be restricted to activated T cells. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.