Human TNFRSF13C/BAFF-R/ BAFFR ORF/cDNA clone-Lentivirus plasmid (NM_052945)

Pre-made Human TNFRSF13C/BAFF-R/ BAFFR Lentiviral expression plasmid for TNFRSF13C lentivirus packaging, TNFRSF13C lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to TNFRSF13C/BAFF-R products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004528 Human TNFRSF13C Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004528
Gene Name TNFRSF13C
Accession Number NM_052945
Gene ID 115650
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 555 bp
Gene Alias BAFF-R, BAFFR, BROMIX, CD268, CVID4, prolixin
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGGCGAGGGCCCCGGAGCCTGCGGGGCAGGGACGCGCCAGCCCCCACGCCCTGCGTCCCGGCCGAGTGCTTCGACCTGCTGGTCCGCCACTGCGTGGCCTGCGGGCTCCTGCGCACGCCGCGGCCGAAACCGGCCGGGGCCAGCAGCCCTGCGCCCAGGACGGCGCTGCAGCCGCAGGAGTCGGTGGGCGCGGGGGCCGGCGAGGCGGCGCTGCCCCTGCCCGGGCTGCTCTTTGGCGCCCCCGCGCTGCTGGGCCTGGCACTGGTCCTGGCGCTGGTCCTGGTGGGTCTGGTGAGCTGGAGGCGGCGACAGCGGCGGCTTCGCGGCGCGTCCTCCGCAGAGGCCCCCGACGGAGACAAGGACGCCCCAGAGCCCCTGGACAAGGTCATCATTCTGTCTCCGGGAATCTCTGATGCCACAGCTCCTGCCTGGCCTCCTCCTGGGGAAGACCCAGGAACCACCCCACCTGGCCACAGTGTCCCTGTGCCAGCCACAGAGCTGGGCTCCACTGAACTGGTGACCACCAAGACGGCCGGCCCTGAGCAACAATAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-256 Pre-Made Ianalumab biosimilar, Whole mAb, Anti-TNFRSF13C Antibody: Anti-BAFF-R/BAFFR/BROMIX/CD268/CVID4/prolixin therapeutic antibody
    Target Antibody GM-Tg-g-T83687-Ab Anti-TR13C/ TNFRSF13C/ BAFF-R monoclonal antibody
    Target Antigen GM-Tg-g-T83687-Ag TNFRSF13C VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T83687 tumor necrosis factor receptor superfamily, member 13C (TNFRSF13C) protein & antibody
    ORF Viral Vector pGMLP004528 Human TNFRSF13C Lentivirus plasmid
    ORF Viral Vector vGMLP004528 Human TNFRSF13C Lentivirus particle


    Target information

    Target ID GM-T83687
    Target Name TNFRSF13C
    Gene ID 115650, 72049, 712577, 500910, 101090370, 607785, 618516, 100070724
    Gene Symbol and Synonyms 2010006P15Rik,BAFF-R,BAFFR,Bcmd,Bcmd-1,Bcmd1,BROMIX,CD268,CVID4,Lvis22,prolixin,RGD1560810,TNFRSF13C
    Uniprot Accession Q96RJ3
    Uniprot Entry Name TR13C_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000159958
    Target Classification Checkpoint-Immuno Oncology

    B cell-activating factor (BAFF) enhances B-cell survival in vitro and is a regulator of the peripheral B-cell population. Overexpression of Baff in mice results in mature B-cell hyperplasia and symptoms of systemic lupus erythematosus (SLE). Also, some SLE patients have increased levels of BAFF in serum. Therefore, it has been proposed that abnormally high levels of BAFF may contribute to the pathogenesis of autoimmune diseases by enhancing the survival of autoreactive B cells. The protein encoded by this gene is a receptor for BAFF and is a type III transmembrane protein containing a single extracellular cysteine-rich domain. It is thought that this receptor is the principal receptor required for BAFF-mediated mature B-cell survival. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.