Human TNFRSF13C/BAFF-R/ BAFFR ORF/cDNA clone-Lentivirus plasmid (NM_052945)
Pre-made Human TNFRSF13C/BAFF-R/ BAFFR Lentiviral expression plasmid for TNFRSF13C lentivirus packaging, TNFRSF13C lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to TNFRSF13C/BAFF-R products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP004528 | Human TNFRSF13C Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP004528 |
Gene Name | TNFRSF13C |
Accession Number | NM_052945 |
Gene ID | 115650 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 555 bp |
Gene Alias | BAFF-R, BAFFR, BROMIX, CD268, CVID4, prolixin |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGGCGAGGGCCCCGGAGCCTGCGGGGCAGGGACGCGCCAGCCCCCACGCCCTGCGTCCCGGCCGAGTGCTTCGACCTGCTGGTCCGCCACTGCGTGGCCTGCGGGCTCCTGCGCACGCCGCGGCCGAAACCGGCCGGGGCCAGCAGCCCTGCGCCCAGGACGGCGCTGCAGCCGCAGGAGTCGGTGGGCGCGGGGGCCGGCGAGGCGGCGCTGCCCCTGCCCGGGCTGCTCTTTGGCGCCCCCGCGCTGCTGGGCCTGGCACTGGTCCTGGCGCTGGTCCTGGTGGGTCTGGTGAGCTGGAGGCGGCGACAGCGGCGGCTTCGCGGCGCGTCCTCCGCAGAGGCCCCCGACGGAGACAAGGACGCCCCAGAGCCCCTGGACAAGGTCATCATTCTGTCTCCGGGAATCTCTGATGCCACAGCTCCTGCCTGGCCTCCTCCTGGGGAAGACCCAGGAACCACCCCACCTGGCCACAGTGTCCCTGTGCCAGCCACAGAGCTGGGCTCCACTGAACTGGTGACCACCAAGACGGCCGGCCCTGAGCAACAATAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-256 | Pre-Made Ianalumab biosimilar, Whole mAb, Anti-TNFRSF13C Antibody: Anti-BAFF-R/BAFFR/BROMIX/CD268/CVID4/prolixin therapeutic antibody |
Target Antibody | GM-Tg-g-T83687-Ab | Anti-TR13C/ TNFRSF13C/ BAFF-R monoclonal antibody |
Target Antigen | GM-Tg-g-T83687-Ag | TNFRSF13C VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-T83687 | tumor necrosis factor receptor superfamily, member 13C (TNFRSF13C) protein & antibody |
ORF Viral Vector | pGMLP004528 | Human TNFRSF13C Lentivirus plasmid |
ORF Viral Vector | vGMLP004528 | Human TNFRSF13C Lentivirus particle |
Target information
Target ID | GM-T83687 |
Target Name | TNFRSF13C |
Gene ID | 115650, 72049, 712577, 500910, 101090370, 607785, 618516, 100070724 |
Gene Symbol and Synonyms | 2010006P15Rik,BAFF-R,BAFFR,Bcmd,Bcmd-1,Bcmd1,BROMIX,CD268,CVID4,Lvis22,prolixin,RGD1560810,TNFRSF13C |
Uniprot Accession | Q96RJ3 |
Uniprot Entry Name | TR13C_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000159958 |
Target Classification | Checkpoint-Immuno Oncology |
B cell-activating factor (BAFF) enhances B-cell survival in vitro and is a regulator of the peripheral B-cell population. Overexpression of Baff in mice results in mature B-cell hyperplasia and symptoms of systemic lupus erythematosus (SLE). Also, some SLE patients have increased levels of BAFF in serum. Therefore, it has been proposed that abnormally high levels of BAFF may contribute to the pathogenesis of autoimmune diseases by enhancing the survival of autoreactive B cells. The protein encoded by this gene is a receptor for BAFF and is a type III transmembrane protein containing a single extracellular cysteine-rich domain. It is thought that this receptor is the principal receptor required for BAFF-mediated mature B-cell survival. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.