Human TNFRSF17/BCM/ BCMA ORF/cDNA clone-Lentivirus plasmid (NM_001192)

Pre-made Human TNFRSF17/BCM/ BCMA Lentiviral expression plasmid for TNFRSF17 lentivirus packaging, TNFRSF17 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to TNFRSF17/BCM products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004529 Human TNFRSF17 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004529
Gene Name TNFRSF17
Accession Number NM_001192
Gene ID 608
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 555 bp
Gene Alias BCM, BCMA, CD269, TNFRSF13A
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTTGCAGATGGCTGGGCAGTGCTCCCAAAATGAATATTTTGACAGTTTGTTGCATGCTTGCATACCTTGTCAACTTCGATGTTCTTCTAATACTCCTCCTCTAACATGTCAGCGTTATTGTAATGCAAGTGTGACCAATTCAGTGAAAGGAACGAATGCGATTCTCTGGACCTGTTTGGGACTGAGCTTAATAATTTCTTTGGCAGTTTTCGTGCTAATGTTTTTGCTAAGGAAGATAAACTCTGAACCATTAAAGGACGAGTTTAAAAACACAGGATCAGGTCTCCTGGGCATGGCTAACATTGACCTGGAAAAGAGCAGGACTGGTGATGAAATTATTCTTCCGAGAGGCCTCGAGTACACGGTGGAAGAATGCACCTGTGAAGACTGCATCAAGAGCAAACCGAAGGTCGACTCTGACCATTGCTTTCCACTCCCAGCTATGGAGGAAGGCGCAACCATTCTTGTCACCACGAAAACGAATGACTATTGCAAGAGCCTGCCAGCTGCTTTGAGTGCTACGGAGATAGAGAAATCAATTTCTGCTAGGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-752 Pre-Made Belantamab Mafodotin Biosimilar, Whole Mab Adc, Anti-Tnfrsf17 Antibody: Anti-BCM/BCMA/CD269/TNFRSF13A therapeutic antibody Drug Conjugate
    Biosimilar GMP-Bios-ab-663 Pre-Made Elranatamab biosimilar, Whole mAb, Anti-TNFRSF17;CD3E Antibody: Anti-BCM/BCMA/CD269/TNFRSF13A;T3E/TCRE/IMD18 therapeutic antibody
    Biosimilar GMP-Bios-ab-433 Pre-Made Pavurutamab biosimilar, Bispecific scFv, Anti-TNFRSF17;CD3E Antibody: Anti-BCM/BCMA/CD269/TNFRSF13A;T3E/TCRE/IMD18 therapeutic antibody
    Biosimilar GMP-Bios-ab-055 Pre-Made Belantamab biosimilar, Whole mAb ADC, Anti-TNFRSF17 Antibody: Anti-BCM/BCMA/CD269/TNFRSF13A therapeutic antibody
    Biosimilar GMP-Bios-ab-421 Pre-Made Pacanalotamab biosimilar, Bispecific scFv, Anti-TNFRSF17;CD3E Antibody: Anti-BCM/BCMA/CD269/TNFRSF13A;T3E/TCRE/IMD18 therapeutic antibody
    Biosimilar GMP-Bios-ab-018 Pre-Made Alnuctamab biosimilar, Bispecific mAb with Domain Crossover, Anti-TNFRSF17;CD3E Antibody: Anti-BCM/BCMA/CD269/TNFRSF13A;T3E/TCRE/IMD18 therapeutic antibody
    Biosimilar GMP-Bios-ab-557 Pre-Made Teclistamab biosimilar, Bispecific mAb, Anti-TNFRSF17;CD3E Antibody: Anti-BCM/BCMA/CD269/TNFRSF13A;T3E/TCRE/IMD18 therapeutic antibody
    Target Antibody GM-Tg-g-T66693-Ab Anti-TNR17/ TNFRSF17/ BCM monoclonal antibody
    Target Antigen GM-Tg-g-T66693-Ag TNFRSF17 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T66693 tumor necrosis factor receptor superfamily, member 17 (TNFRSF17) protein & antibody
    ORF Viral Vector pGMLP004529 Human TNFRSF17 Lentivirus plasmid
    ORF Viral Vector vGMLP004529 Human TNFRSF17 Lentivirus particle


    Target information

    Target ID GM-T66693
    Target Name TNFRSF17
    Gene ID 608, 21935, 712212, 287034, 101086618, 100684674, 784268, 100055833
    Gene Symbol and Synonyms BCM,BCMA,CD269,Tnfrsf13,TNFRSF13A,TNFRSF17
    Uniprot Accession Q02223
    Uniprot Entry Name TNR17_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000048462
    Target Classification Checkpoint-Immuno Oncology, Immune cell receptor, Tumor-associated antigen (TAA)

    The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is preferentially expressed in mature B lymphocytes, and may be important for B cell development and autoimmune response. This receptor has been shown to specifically bind to the tumor necrosis factor (ligand) superfamily, member 13b (TNFSF13B/TALL-1/BAFF), and to lead to NF-kappaB and MAPK8/JNK activation. This receptor also binds to various TRAF family members, and thus may transduce signals for cell survival and proliferation. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.