Human TNFRSF17/BCM/ BCMA ORF/cDNA clone-Lentivirus plasmid (NM_001192)
Pre-made Human TNFRSF17/BCM/ BCMA Lentiviral expression plasmid for TNFRSF17 lentivirus packaging, TNFRSF17 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to TNFRSF17/BCM products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP004529 | Human TNFRSF17 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP004529 |
Gene Name | TNFRSF17 |
Accession Number | NM_001192 |
Gene ID | 608 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 555 bp |
Gene Alias | BCM, BCMA, CD269, TNFRSF13A |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTTGCAGATGGCTGGGCAGTGCTCCCAAAATGAATATTTTGACAGTTTGTTGCATGCTTGCATACCTTGTCAACTTCGATGTTCTTCTAATACTCCTCCTCTAACATGTCAGCGTTATTGTAATGCAAGTGTGACCAATTCAGTGAAAGGAACGAATGCGATTCTCTGGACCTGTTTGGGACTGAGCTTAATAATTTCTTTGGCAGTTTTCGTGCTAATGTTTTTGCTAAGGAAGATAAACTCTGAACCATTAAAGGACGAGTTTAAAAACACAGGATCAGGTCTCCTGGGCATGGCTAACATTGACCTGGAAAAGAGCAGGACTGGTGATGAAATTATTCTTCCGAGAGGCCTCGAGTACACGGTGGAAGAATGCACCTGTGAAGACTGCATCAAGAGCAAACCGAAGGTCGACTCTGACCATTGCTTTCCACTCCCAGCTATGGAGGAAGGCGCAACCATTCTTGTCACCACGAAAACGAATGACTATTGCAAGAGCCTGCCAGCTGCTTTGAGTGCTACGGAGATAGAGAAATCAATTTCTGCTAGGTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Target information
Target ID | GM-T66693 |
Target Name | TNFRSF17 |
Gene ID | 608, 21935, 712212, 287034, 101086618, 100684674, 784268, 100055833 |
Gene Symbol and Synonyms | BCM,BCMA,CD269,Tnfrsf13,TNFRSF13A,TNFRSF17 |
Uniprot Accession | Q02223 |
Uniprot Entry Name | TNR17_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000048462 |
Target Classification | Checkpoint-Immuno Oncology, Immune cell receptor, Tumor-associated antigen (TAA) |
The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is preferentially expressed in mature B lymphocytes, and may be important for B cell development and autoimmune response. This receptor has been shown to specifically bind to the tumor necrosis factor (ligand) superfamily, member 13b (TNFSF13B/TALL-1/BAFF), and to lead to NF-kappaB and MAPK8/JNK activation. This receptor also binds to various TRAF family members, and thus may transduce signals for cell survival and proliferation. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.