Human TNFSF15/TL1/ TL1A ORF/cDNA clone-Lentivirus plasmid (NM_005118)

Pre-made Human TNFSF15/TL1/ TL1A Lentiviral expression plasmid for TNFSF15 lentivirus packaging, TNFSF15 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to TNFSF15/TL1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004530 Human TNFSF15 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004530
Gene Name TNFSF15
Accession Number NM_005118
Gene ID 9966
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 756 bp
Gene Alias TL1, TL1A, TNLG1B, VEGI, VEGI192A
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCCGAGGATCTGGGACTGAGCTTTGGGGAAACAGCCAGTGTGGAAATGCTGCCAGAGCACGGCAGCTGCAGGCCCAAGGCCAGGAGCAGCAGCGCACGCTGGGCTCTCACCTGCTGCCTGGTGTTGCTCCCCTTCCTTGCAGGACTCACCACATACCTGCTTGTCAGCCAGCTCCGGGCCCAGGGAGAGGCCTGTGTGCAGTTCCAGGCTCTAAAAGGACAGGAGTTTGCACCTTCACATCAGCAAGTTTATGCACCTCTTAGAGCAGACGGAGATAAGCCAAGGGCACACCTGACAGTTGTGAGACAAACTCCCACACAGCACTTTAAAAATCAGTTCCCAGCTCTGCACTGGGAACATGAACTAGGCCTGGCCTTCACCAAGAACCGAATGAACTATACCAACAAATTCCTGCTGATCCCAGAGTCGGGAGACTACTTCATTTACTCCCAGGTCACATTCCGTGGGATGACCTCTGAGTGCAGTGAAATCAGACAAGCAGGCCGACCAAACAAGCCAGACTCCATCACTGTGGTCATCACCAAGGTAACAGACAGCTACCCTGAGCCAACCCAGCTCCTCATGGGGACCAAGTCTGTATGCGAAGTAGGTAGCAACTGGTTCCAGCCCATCTACCTCGGAGCCATGTTCTCCTTGCAAGAAGGGGACAAGCTAATGGTGAACGTCAGTGACATCTCTTTGGTGGATTACACAAAAGAAGATAAAACCTTCTTTGGAGCCTTCTTACTATAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T35212-Ab Anti-TNF15/ TNFSF15/ TL1 monoclonal antibody
    Target Antigen GM-Tg-g-T35212-Ag TNFSF15 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T35212 Tumor necrosis factor superfamily member 15 (TNFSF15) protein & antibody
    ORF Viral Vector pGMAAV000281 Human TNFSF15 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMLP004530 Human TNFSF15 Lentivirus plasmid
    ORF Viral Vector vGMAAV000281 Human TNFSF15 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP004530 Human TNFSF15 Lentivirus particle


    Target information

    Target ID GM-T35212
    Target Name TNFSF15
    Gene ID 9966, 326623, 703189, 252878, 101099505, 481688, 514239, 100049906
    Gene Symbol and Synonyms TL1,TL1A,TNFSF15,TNLG1B,VEGI,VEGI192A
    Uniprot Accession O95150
    Uniprot Entry Name TNF15_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000181634
    Target Classification Not Available

    The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This protein is abundantly expressed in endothelial cells, but is not expressed in either B or T cells. The expression of this protein is inducible by TNF and IL-1 alpha. This cytokine is a ligand for receptor TNFRSF25 and decoy receptor TNFRSF21/DR6. It can activate NF-kappaB and MAP kinases, and acts as an autocrine factor to induce apoptosis in endothelial cells. This cytokine is also found to inhibit endothelial cell proliferation, and thus may function as an angiogenesis inhibitor. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.