Human TNFSF15/TL1/ TL1A ORF/cDNA clone-Lentivirus plasmid (NM_005118)
Pre-made Human TNFSF15/TL1/ TL1A Lentiviral expression plasmid for TNFSF15 lentivirus packaging, TNFSF15 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to TNFSF15/TL1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP004530 | Human TNFSF15 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP004530 |
Gene Name | TNFSF15 |
Accession Number | NM_005118 |
Gene ID | 9966 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 756 bp |
Gene Alias | TL1, TL1A, TNLG1B, VEGI, VEGI192A |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCCGAGGATCTGGGACTGAGCTTTGGGGAAACAGCCAGTGTGGAAATGCTGCCAGAGCACGGCAGCTGCAGGCCCAAGGCCAGGAGCAGCAGCGCACGCTGGGCTCTCACCTGCTGCCTGGTGTTGCTCCCCTTCCTTGCAGGACTCACCACATACCTGCTTGTCAGCCAGCTCCGGGCCCAGGGAGAGGCCTGTGTGCAGTTCCAGGCTCTAAAAGGACAGGAGTTTGCACCTTCACATCAGCAAGTTTATGCACCTCTTAGAGCAGACGGAGATAAGCCAAGGGCACACCTGACAGTTGTGAGACAAACTCCCACACAGCACTTTAAAAATCAGTTCCCAGCTCTGCACTGGGAACATGAACTAGGCCTGGCCTTCACCAAGAACCGAATGAACTATACCAACAAATTCCTGCTGATCCCAGAGTCGGGAGACTACTTCATTTACTCCCAGGTCACATTCCGTGGGATGACCTCTGAGTGCAGTGAAATCAGACAAGCAGGCCGACCAAACAAGCCAGACTCCATCACTGTGGTCATCACCAAGGTAACAGACAGCTACCCTGAGCCAACCCAGCTCCTCATGGGGACCAAGTCTGTATGCGAAGTAGGTAGCAACTGGTTCCAGCCCATCTACCTCGGAGCCATGTTCTCCTTGCAAGAAGGGGACAAGCTAATGGTGAACGTCAGTGACATCTCTTTGGTGGATTACACAAAAGAAGATAAAACCTTCTTTGGAGCCTTCTTACTATAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T35212-Ab | Anti-TNF15/ TNFSF15/ TL1 monoclonal antibody |
Target Antigen | GM-Tg-g-T35212-Ag | TNFSF15 VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-T35212 | Tumor necrosis factor superfamily member 15 (TNFSF15) protein & antibody |
ORF Viral Vector | pGMAAV000281 | Human TNFSF15 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMLP004530 | Human TNFSF15 Lentivirus plasmid |
ORF Viral Vector | vGMAAV000281 | Human TNFSF15 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMLP004530 | Human TNFSF15 Lentivirus particle |
Target information
Target ID | GM-T35212 |
Target Name | TNFSF15 |
Gene ID | 9966, 326623, 703189, 252878, 101099505, 481688, 514239, 100049906 |
Gene Symbol and Synonyms | TL1,TL1A,TNFSF15,TNLG1B,VEGI,VEGI192A |
Uniprot Accession | O95150 |
Uniprot Entry Name | TNF15_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000181634 |
Target Classification | Not Available |
The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This protein is abundantly expressed in endothelial cells, but is not expressed in either B or T cells. The expression of this protein is inducible by TNF and IL-1 alpha. This cytokine is a ligand for receptor TNFRSF25 and decoy receptor TNFRSF21/DR6. It can activate NF-kappaB and MAP kinases, and acts as an autocrine factor to induce apoptosis in endothelial cells. This cytokine is also found to inhibit endothelial cell proliferation, and thus may function as an angiogenesis inhibitor. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.