Human TNFSF8/CD153/ CD30L ORF/cDNA clone-Lentivirus plasmid (NM_001244)
Pre-made Human TNFSF8/CD153/ CD30L Lentiviral expression plasmid for TNFSF8 lentivirus packaging, TNFSF8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to TNFSF8/CD153 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP004531 | Human TNFSF8 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP004531 |
Gene Name | TNFSF8 |
Accession Number | NM_001244 |
Gene ID | 944 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 705 bp |
Gene Alias | CD153, CD30L, CD30LG, TNLG3A |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGACCCAGGGCTGCAGCAAGCACTCAACGGAATGGCCCCTCCTGGAGACACAGCCATGCATGTGCCGGCGGGCTCCGTGGCCAGCCACCTGGGGACCACGAGCCGCAGCTATTTCTATTTGACCACAGCCACTCTGGCTCTGTGCCTTGTCTTCACGGTGGCCACTATTATGGTGTTGGTCGTTCAGAGGACGGACTCCATTCCCAACTCACCTGACAACGTCCCCCTCAAAGGAGGAAATTGCTCAGAAGACCTCTTATGTATCCTGAAAAGGGCTCCATTCAAGAAGTCATGGGCCTACCTCCAAGTGGCAAAGCATCTAAACAAAACCAAGTTGTCTTGGAACAAAGATGGCATTCTCCATGGAGTCAGATATCAGGATGGGAATCTGGTGATCCAATTCCCTGGTTTGTACTTCATCATTTGCCAACTGCAGTTTCTTGTACAATGCCCAAATAATTCTGTCGATCTGAAGTTGGAGCTTCTCATCAACAAGCATATCAAAAAACAGGCCCTGGTGACAGTGTGTGAGTCTGGAATGCAAACGAAACACGTATACCAGAATCTCTCTCAATTCTTGCTGGATTACCTGCAGGTCAACACCACCATATCAGTCAATGTGGATACATTCCAGTACATAGATACAAGCACCTTTCCTCTTGAGAATGTGTTGTCCATCTTCTTATACAGTAATTCAGACTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP1859-Ab | Anti-TNFL8/ TNFSF8/ CD153 monoclonal antibody |
Target Antigen | GM-Tg-g-MP1859-Ag | TNFSF8 VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-MP1859 | tumor necrosis factor (ligand) superfamily, member 8 (Tnfsf8) protein & antibody |
ORF Viral Vector | pGMLP004531 | Human TNFSF8 Lentivirus plasmid |
ORF Viral Vector | vGMLP004531 | Human TNFSF8 Lentivirus particle |
Target information
Target ID | GM-MP1859 |
Target Name | TNFSF8 |
Gene ID | 944, 21949, 702944, 683163, 101099756, 612608, 574056, 100051061 |
Gene Symbol and Synonyms | CD153,CD30L,CD30LG,TNFRSF8,TNFSF8,TNLG3A |
Uniprot Accession | P32971 |
Uniprot Entry Name | TNFL8_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Cytokine Target |
Disease | Lung Cancer |
Gene Ensembl | ENSG00000106952 |
Target Classification | Not Available |
The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for TNFRSF8/CD30, which is a cell surface antigen and a marker for Hodgkin lymphoma and related hematologic malignancies. The engagement of this cytokine expressed on B cell surface plays an inhibitory role in modulating Ig class switch. This cytokine was shown to enhance cell proliferation of some lymphoma cell lines, while to induce cell death and reduce cell proliferation of other lymphoma cell lines. The pleiotropic biologic activities of this cytokine on different CD30+ lymphoma cell lines may play a pathophysiologic role in Hodgkin's and some non-Hodgkin's lymphomas. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.