Human TNFSF8/CD153/ CD30L ORF/cDNA clone-Lentivirus plasmid (NM_001244)

Pre-made Human TNFSF8/CD153/ CD30L Lentiviral expression plasmid for TNFSF8 lentivirus packaging, TNFSF8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to TNFSF8/CD153 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004531 Human TNFSF8 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004531
Gene Name TNFSF8
Accession Number NM_001244
Gene ID 944
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 705 bp
Gene Alias CD153, CD30L, CD30LG, TNLG3A
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGACCCAGGGCTGCAGCAAGCACTCAACGGAATGGCCCCTCCTGGAGACACAGCCATGCATGTGCCGGCGGGCTCCGTGGCCAGCCACCTGGGGACCACGAGCCGCAGCTATTTCTATTTGACCACAGCCACTCTGGCTCTGTGCCTTGTCTTCACGGTGGCCACTATTATGGTGTTGGTCGTTCAGAGGACGGACTCCATTCCCAACTCACCTGACAACGTCCCCCTCAAAGGAGGAAATTGCTCAGAAGACCTCTTATGTATCCTGAAAAGGGCTCCATTCAAGAAGTCATGGGCCTACCTCCAAGTGGCAAAGCATCTAAACAAAACCAAGTTGTCTTGGAACAAAGATGGCATTCTCCATGGAGTCAGATATCAGGATGGGAATCTGGTGATCCAATTCCCTGGTTTGTACTTCATCATTTGCCAACTGCAGTTTCTTGTACAATGCCCAAATAATTCTGTCGATCTGAAGTTGGAGCTTCTCATCAACAAGCATATCAAAAAACAGGCCCTGGTGACAGTGTGTGAGTCTGGAATGCAAACGAAACACGTATACCAGAATCTCTCTCAATTCTTGCTGGATTACCTGCAGGTCAACACCACCATATCAGTCAATGTGGATACATTCCAGTACATAGATACAAGCACCTTTCCTCTTGAGAATGTGTTGTCCATCTTCTTATACAGTAATTCAGACTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1859-Ab Anti-TNFL8/ TNFSF8/ CD153 monoclonal antibody
    Target Antigen GM-Tg-g-MP1859-Ag TNFSF8 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-MP1859 tumor necrosis factor (ligand) superfamily, member 8 (Tnfsf8) protein & antibody
    ORF Viral Vector pGMLP004531 Human TNFSF8 Lentivirus plasmid
    ORF Viral Vector vGMLP004531 Human TNFSF8 Lentivirus particle


    Target information

    Target ID GM-MP1859
    Target Name TNFSF8
    Gene ID 944, 21949, 702944, 683163, 101099756, 612608, 574056, 100051061
    Gene Symbol and Synonyms CD153,CD30L,CD30LG,TNFRSF8,TNFSF8,TNLG3A
    Uniprot Accession P32971
    Uniprot Entry Name TNFL8_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Cytokine Target
    Disease Lung Cancer
    Gene Ensembl ENSG00000106952
    Target Classification Not Available

    The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for TNFRSF8/CD30, which is a cell surface antigen and a marker for Hodgkin lymphoma and related hematologic malignancies. The engagement of this cytokine expressed on B cell surface plays an inhibitory role in modulating Ig class switch. This cytokine was shown to enhance cell proliferation of some lymphoma cell lines, while to induce cell death and reduce cell proliferation of other lymphoma cell lines. The pleiotropic biologic activities of this cytokine on different CD30+ lymphoma cell lines may play a pathophysiologic role in Hodgkin's and some non-Hodgkin's lymphomas. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.