Human RAB7A/PRO2706/RAB7 ORF/cDNA clone-Lentivirus plasmid (NM_004637)

Cat. No.: pGMLP004585
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human RAB7A/PRO2706/RAB7 Lentiviral expression plasmid for RAB7A lentivirus packaging, RAB7A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to RAB7A/PRO2706 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $456
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004585
Gene Name RAB7A
Accession Number NM_004637
Gene ID 7879
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 624 bp
Gene Alias PRO2706,RAB7
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACCTCTAGGAAGAAAGTGTTGCTGAAGGTTATCATCCTGGGAGATTCTGGAGTCGGGAAGACATCACTCATGAACCAGTATGTGAATAAGAAATTCAGCAATCAGTACAAAGCCACAATAGGAGCTGACTTTCTGACCAAGGAGGTGATGGTGGATGACAGGCTAGTCACAATGCAGATATGGGACACAGCAGGACAGGAACGGTTCCAGTCTCTCGGTGTGGCCTTCTACAGAGGTGCAGACTGCTGCGTTCTGGTATTTGATGTGACTGCCCCCAACACATTCAAAACCCTAGATAGCTGGAGAGATGAGTTTCTCATCCAGGCCAGTCCCCGAGATCCTGAAAACTTCCCATTTGTTGTGTTGGGAAACAAGATTGACCTCGAAAACAGACAAGTGGCCACAAAGCGGGCACAGGCCTGGTGCTACAGCAAAAACAACATTCCCTACTTTGAGACCAGTGCCAAGGAGGCCATCAACGTGGAGCAGGCGTTCCAGACGATTGCACGGAATGCACTTAAGCAGGAAACGGAGGTGGAGCTGTACAACGAATTTCCTGAACCTATCAAACTGGACAAGAATGACCGGGCCAAGGCCTCGGCAGAAAGCTGCAGTTGCTGA
ORF Protein Sequence MTSRKKVLLKVIILGDSGVGKTSLMNQYVNKKFSNQYKATIGADFLTKEVMVDDRLVTMQIWDTAGQERFQSLGVAFYRGADCCVLVFDVTAPNTFKTLDSWRDEFLIQASPRDPENFPFVVLGNKIDLENRQVATKRAQAWCYSKNNIPYFETSAKEAINVEQAFQTIARNALKQETEVELYNEFPEPIKLDKNDRAKASAESCSC

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T14030-Ab Anti-RAB7A monoclonal antibody
    Target Antigen GM-Tg-g-T14030-Ag RAB7A protein
    ORF Viral Vector pGMLP004585 Human RAB7A Lentivirus plasmid
    ORF Viral Vector pGMLV001325 Human RAB7A Lentivirus plasmid
    ORF Viral Vector pGMLV002468 Human RAB7A Lentivirus plasmid
    ORF Viral Vector pGMPC000402 Human RAB7A Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000494 Human RAB7A Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP004585 Human RAB7A Lentivirus particle
    ORF Viral Vector vGMLV001325 Human RAB7A Lentivirus particle
    ORF Viral Vector vGMLV002468 Human RAB7A Lentivirus particle


    Target information

    Target ID GM-T14030
    Target Name RAB7A
    Gene ID 7879, 19349, 707280, 29448, 101085959, 404007, 509970, 100050015
    Gene Symbol and Synonyms CMT2B,PRO2706,RAB7,RAB7A
    Uniprot Accession P51149
    Uniprot Entry Name RAB7A_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000075785
    Target Classification Not Available

    RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.