Human RAB7A/CMT2B/PRO2706 ORF/cDNA clone-Lentivirus plasmid (NM_004637)
Cat. No.: pGMLV001325
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human RAB7A/CMT2B/PRO2706 Lentiviral expression plasmid for RAB7A lentivirus packaging, RAB7A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
RAB7A/CMT2B products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLV001325 |
Gene Name | RAB7A |
Accession Number | NM_004637 |
Gene ID | 7879 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 624 bp |
Gene Alias | CMT2B,PRO2706,RAB7 |
Fluorescent Reporter | Null |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGACCTCTAGGAAGAAAGTGTTGCTGAAGGTTATCATCCTGGGAGATTCTGGAGTCGGGAAGACATCACTCATGAACCAGTATGTGAATAAGAAATTCAGCAATCAGTACAAAGCCACAATAGGAGCTGACTTTCTGACCAAGGAGGTGATGGTGGATGACAGGCTAGTCACAATGCAGATATGGGACACAGCAGGACAGGAACGGTTCCAGTCTCTCGGTGTGGCCTTCTACAGAGGTGCAGACTGCTGCGTTCTGGTATTTGATGTGACTGCCCCCAACACATTCAAAACCCTAGATAGCTGGAGAGATGAGTTTCTCATCCAGGCCAGTCCCCGAGATCCTGAAAACTTCCCATTTGTTGTGTTGGGAAACAAGATTGACCTCGAAAACAGACAAGTGGCCACAAAGCGGGCACAGGCCTGGTGCTACAGCAAAAACAACATTCCCTACTTTGAGACCAGTGCCAAGGAGGCCATCAACGTGGAGCAGGCGTTCCAGACGATTGCACGGAATGCACTTAAGCAGGAAACGGAGGTGGAGCTGTACAACGAATTTCCTGAACCTATCAAACTGGACAAGAATGACCGGGCCAAGGCCTCGGCAGAAAGCTGCAGTTGCTGA |
ORF Protein Sequence | MTSRKKVLLKVIILGDSGVGKTSLMNQYVNKKFSNQYKATIGADFLTKEVMVDDRLVTMQIWDTAGQERFQSLGVAFYRGADCCVLVFDVTAPNTFKTLDSWRDEFLIQASPRDPENFPFVVLGNKIDLENRQVATKRAQAWCYSKNNIPYFETSAKEAINVEQAFQTIARNALKQETEVELYNEFPEPIKLDKNDRAKASAESCSC |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T14030-Ab | Anti-RAB7A monoclonal antibody |
Target Antigen | GM-Tg-g-T14030-Ag | RAB7A protein |
ORF Viral Vector | pGMLP004585 | Human RAB7A Lentivirus plasmid |
ORF Viral Vector | pGMLV001325 | Human RAB7A Lentivirus plasmid |
ORF Viral Vector | pGMLV002468 | Human RAB7A Lentivirus plasmid |
ORF Viral Vector | pGMPC000402 | Human RAB7A Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC000494 | Human RAB7A Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLP004585 | Human RAB7A Lentivirus particle |
ORF Viral Vector | vGMLV001325 | Human RAB7A Lentivirus particle |
ORF Viral Vector | vGMLV002468 | Human RAB7A Lentivirus particle |
Target information
Target ID | GM-T14030 |
Target Name | RAB7A |
Gene ID | 7879, 19349, 707280, 29448, 101085959, 404007, 509970, 100050015 |
Gene Symbol and Synonyms | CMT2B,PRO2706,RAB7,RAB7A |
Uniprot Accession | P51149 |
Uniprot Entry Name | RAB7A_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000075785 |
Target Classification | Not Available |
RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.