Human CYBA/p22-PHOX ORF/cDNA clone-Lentivirus plasmid (NM_000101)

Cat. No.: pGMLP004603
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CYBA/p22-PHOX Lentiviral expression plasmid for CYBA lentivirus packaging, CYBA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to CYBA/p22-PHOX products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $447
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004603
Gene Name CYBA
Accession Number NM_000101
Gene ID 1535
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 588 bp
Gene Alias p22-PHOX
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGGCAGATCGAGTGGGCCATGTGGGCCAACGAACAGGCGCTGGCGTCCGGCCTGATCCTCATCACCGGGGGCATCGTGGCCACAGCTGGGCGCTTCACCCAGTGGTACTTTGGTGCCTACTCCATTGTGGCGGGCGTGTTTGTGTGCCTGCTGGAGTACCCCCGGGGGAAGAGGAAGAAGGGCTCCACCATGGAGCGCTGGGGACAGAAGTACATGACCGCCGTGGTGAAGCTGTTCGGGCCCTTTACCAGGAATTACTATGTTCGGGCCGTCCTGCATCTCCTGCTCTCGGTGCCCGCCGGCTTCCTGCTGGCCACCATCCTTGGGACCGCCTGCCTGGCCATTGCGAGCGGCATCTACCTACTGGCGGCTGTGCGTGGCGAGCAGTGGACGCCCATCGAGCCCAAGCCCCGGGAGCGGCCGCAGATCGGAGGCACCATCAAGCAGCCGCCCAGCAACCCCCCGCCGCGGCCCCCGGCCGAGGCCCGCAAGAAGCCCAGCGAGGAGGAGGCTGCGGTGGCGGCGGGGGGACCCCCGGGAGGTCCCCAGGTCAACCCCATCCCGGTGACCGACGAGGTCGTGTGA
ORF Protein Sequence MGQIEWAMWANEQALASGLILITGGIVATAGRFTQWYFGAYSIVAGVFVCLLEYPRGKRKKGSTMERWGQKYMTAVVKLFGPFTRNYYVRAVLHLLLSVPAGFLLATILGTACLAIASGIYLLAAVRGEQWTPIEPKPRERPQIGGTIKQPPSNPPPRPPAEARKKPSEEEAAVAAGGPPGGPQVNPIPVTDEVV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0344-Ab Anti-CY24A/ CYBA/ p22-PHOX monoclonal antibody
    Target Antigen GM-Tg-g-MP0344-Ag CYBA VLP (virus-like particle)
    ORF Viral Vector pGMLP004603 Human CYBA Lentivirus plasmid
    ORF Viral Vector vGMLP004603 Human CYBA Lentivirus particle


    Target information

    Target ID GM-MP0344
    Target Name CYBA
    Gene ID 1535, 13057, 696748, 79129, 101091745, 489664, 281111, 100049843
    Gene Symbol and Synonyms b558,CGD4,CYBA,nmf333,p22-PHOX,p22phox,Phox
    Uniprot Accession P13498
    Uniprot Entry Name CY24A_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000051523
    Target Classification Not Available

    Cytochrome b is comprised of a light chain (alpha) and a heavy chain (beta). This gene encodes the light, alpha subunit which has been proposed as a primary component of the microbicidal oxidase system of phagocytes. Mutations in this gene are associated with autosomal recessive chronic granulomatous disease (CGD), that is characterized by the failure of activated phagocytes to generate superoxide, which is important for the microbicidal activity of these cells. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.