Human CYBA/p22-PHOX ORF/cDNA clone-Lentivirus plasmid (NM_000101)
Cat. No.: pGMLP004603
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human CYBA/p22-PHOX Lentiviral expression plasmid for CYBA lentivirus packaging, CYBA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
CYBA/p22-PHOX products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP004603 |
Gene Name | CYBA |
Accession Number | NM_000101 |
Gene ID | 1535 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 588 bp |
Gene Alias | p22-PHOX |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGGGCAGATCGAGTGGGCCATGTGGGCCAACGAACAGGCGCTGGCGTCCGGCCTGATCCTCATCACCGGGGGCATCGTGGCCACAGCTGGGCGCTTCACCCAGTGGTACTTTGGTGCCTACTCCATTGTGGCGGGCGTGTTTGTGTGCCTGCTGGAGTACCCCCGGGGGAAGAGGAAGAAGGGCTCCACCATGGAGCGCTGGGGACAGAAGTACATGACCGCCGTGGTGAAGCTGTTCGGGCCCTTTACCAGGAATTACTATGTTCGGGCCGTCCTGCATCTCCTGCTCTCGGTGCCCGCCGGCTTCCTGCTGGCCACCATCCTTGGGACCGCCTGCCTGGCCATTGCGAGCGGCATCTACCTACTGGCGGCTGTGCGTGGCGAGCAGTGGACGCCCATCGAGCCCAAGCCCCGGGAGCGGCCGCAGATCGGAGGCACCATCAAGCAGCCGCCCAGCAACCCCCCGCCGCGGCCCCCGGCCGAGGCCCGCAAGAAGCCCAGCGAGGAGGAGGCTGCGGTGGCGGCGGGGGGACCCCCGGGAGGTCCCCAGGTCAACCCCATCCCGGTGACCGACGAGGTCGTGTGA |
ORF Protein Sequence | MGQIEWAMWANEQALASGLILITGGIVATAGRFTQWYFGAYSIVAGVFVCLLEYPRGKRKKGSTMERWGQKYMTAVVKLFGPFTRNYYVRAVLHLLLSVPAGFLLATILGTACLAIASGIYLLAAVRGEQWTPIEPKPRERPQIGGTIKQPPSNPPPRPPAEARKKPSEEEAAVAAGGPPGGPQVNPIPVTDEVV |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP0344-Ab | Anti-CY24A/ CYBA/ p22-PHOX monoclonal antibody |
Target Antigen | GM-Tg-g-MP0344-Ag | CYBA VLP (virus-like particle) |
ORF Viral Vector | pGMLP004603 | Human CYBA Lentivirus plasmid |
ORF Viral Vector | vGMLP004603 | Human CYBA Lentivirus particle |
Target information
Target ID | GM-MP0344 |
Target Name | CYBA |
Gene ID | 1535, 13057, 696748, 79129, 101091745, 489664, 281111, 100049843 |
Gene Symbol and Synonyms | b558,CGD4,CYBA,nmf333,p22-PHOX,p22phox,Phox |
Uniprot Accession | P13498 |
Uniprot Entry Name | CY24A_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000051523 |
Target Classification | Not Available |
Cytochrome b is comprised of a light chain (alpha) and a heavy chain (beta). This gene encodes the light, alpha subunit which has been proposed as a primary component of the microbicidal oxidase system of phagocytes. Mutations in this gene are associated with autosomal recessive chronic granulomatous disease (CGD), that is characterized by the failure of activated phagocytes to generate superoxide, which is important for the microbicidal activity of these cells. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.