Human GLO1/GLOD1/ GLYI ORF/cDNA clone-Lentivirus plasmid (NM_006708)

Pre-made Human GLO1/GLOD1/ GLYI Lentiviral expression plasmid for GLO1 lentivirus packaging, GLO1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to GLO1/GLOD1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004608 Human GLO1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004608
Gene Name GLO1
Accession Number NM_006708
Gene ID 2739
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 555 bp
Gene Alias GLOD1, GLYI, HEL-S-74
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCAGAACCGCAGCCCCCGTCCGGCGGCCTCACGGACGAGGCCGCCCTCAGTTGCTGCTCCGACGCGGACCCCAGTACCAAGGATTTTCTATTGCAGCAGACCATGCTACGAGTGAAGGATCCTAAGAAGTCACTGGATTTTTATACTAGAGTTCTTGGAATGACGCTAATCCAAAAATGTGATTTTCCCATTATGAAGTTTTCACTCTACTTCTTGGCTTATGAGGATAAAAATGACATCCCTAAAGAAAAAGATGAAAAAATAGCCTGGGCGCTCTCCAGAAAAGCTACACTTGAGCTGACACACAATTGGGGCACTGAAGATGATGAGACCCAGAGTTACCACAATGGCAATTCAGACCCTCGAGGATTCGGTCATATTGGAATTGCTGTTCCTGATGTATACAGTGCTTGTAAAAGGTTTGAAGAACTGGGAGTCAAATTTGTGAAGAAACCTGATGATGGTAAAATGAAAGGCCTGGCATTTATTCAAGATCCTGATGGCTACTGGATTGAAATTTTGAATCCTAACAAAATGGCAACCTTAATGTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T88285-Ab Anti-LGUL/ GLO1/ GLOD1 monoclonal antibody
    Target Antigen GM-Tg-g-T88285-Ag GLO1 VLP (virus-like particle)
    ORF Viral Vector pGMLV000001 Rat Glo1 Lentivirus plasmid
    ORF Viral Vector pGMLP004608 Human GLO1 Lentivirus plasmid
    ORF Viral Vector vGMLV000001 Rat Glo1 Lentivirus particle
    ORF Viral Vector vGMLP004608 Human GLO1 Lentivirus particle


    Target information

    Target ID GM-T88285
    Target Name GLO1
    Gene ID 2739, 109801, 719518, 294320, 101085123, 474894, 540335, 100065189
    Gene Symbol and Synonyms 0610009E22Rik,1110008E19Rik,2510049H23Rik,Glo-1,Glo-1r,Glo-1s,GLO1,Glo1-r,Glo1-s,GLOD1,GLY1,GLYI,HEL-S-74,Qglo
    Uniprot Accession Q04760
    Uniprot Entry Name LGUL_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Breast Cancer
    Gene Ensembl ENSG00000124767
    Target Classification Not Available

    The enzyme encoded by this gene is responsible for the catalysis and formation of S-lactoyl-glutathione from methylglyoxal condensation and reduced glutatione.  Glyoxalase I is linked to HLA and is localized to 6p21.3-p21.1, between HLA and the centromere. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.