Human GPCR/GPCR/MRGX3 ORF/cDNA clone-Lentivirus plasmid (NM_054031)

Cat. No.: pGMLP004680
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human GPCR/GPCR/MRGX3 Lentiviral expression plasmid for GPCR lentivirus packaging, GPCR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to MRGPRX3/GPCR products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $542.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004680
Gene Name GPCR
Accession Number NM_054031
Gene ID 117195
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 969 bp
Gene Alias GPCR,MRGX3,SNSR1,SNSR2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGATTCAACCATCCCAGTCTTGGGTACAGAACTGACACCAATCAACGGACGTGAGGAGACTCCTTGCTACAAGCAGACCCTGAGCTTCACGGGGCTGACGTGCATCGTTTCCCTTGTCGCGCTGACAGGAAACGCGGTTGTGCTCTGGCTCCTGGGCTGCCGCATGCGCAGGAACGCTGTCTCCATCTACATCCTCAACCTGGTCGCGGCCGACTTCCTCTTCCTTAGCGGCCACATTATATGTTCGCCGTTACGCCTCATCAATATCCGCCATCCCATCTCCAAAATCCTCAGTCCTGTGATGACCTTTCCCTACTTTATAGGCCTAAGCATGCTGAGCGCCATCAGCACCGAGCGCTGCCTGTCCATCCTGTGGCCCATCTGGTACCACTGCCGCCGCCCCAGATACCTGTCATCAGTCATGTGTGTCCTGCTCTGGGCCCTGTCCCTGCTGCGGAGTATCCTGGAGTGGATGTTCTGTGACTTCCTGTTTAGTGGTGCTAATTCTGTTTGGTGTGAAACGTCAGATTTCATTACAATCGCGTGGCTGGTTTTTTTATGTGTGGTTCTCTGTGGGTCCAGCCTGGTCCTGCTGGTCAGGATTCTCTGTGGATCCCGGAAGATGCCGCTGACCAGGCTGTACGTGACCATCCTCCTCACAGTGCTGGTCTTCCTCCTCTGTGGCCTGCCCTTTGGCATTCAGTGGGCCCTGTTTTCCAGGATCCACCTGGATTGGAAAGTCTTATTTTGTCATGTGCATCTAGTTTCCATTTTCCTGTCCGCTCTTAACAGCAGTGCCAACCCCATCATTTACTTCTTCGTGGGCTCCTTTAGGCAGCGTCAAAATAGGCAGAACCTGAAGCTGGTTCTCCAGAGGGCTCTGCAGGACACGCCTGAGGTGGATGAAGGTGGAGGGTGGCTTCCTCAGGAAACCCTGGAGCTGTCGGGAAGCAGATTGGAGCAGTGA
ORF Protein Sequence MDSTIPVLGTELTPINGREETPCYKQTLSFTGLTCIVSLVALTGNAVVLWLLGCRMRRNAVSIYILNLVAADFLFLSGHIICSPLRLINIRHPISKILSPVMTFPYFIGLSMLSAISTERCLSILWPIWYHCRRPRYLSSVMCVLLWALSLLRSILEWMFCDFLFSGANSVWCETSDFITIAWLVFLCVVLCGSSLVLLVRILCGSRKMPLTRLYVTILLTVLVFLLCGLPFGIQWALFSRIHLDWKVLFCHVHLVSIFLSALNSSANPIIYFFVGSFRQRQNRQNLKLVLQRALQDTPEVDEGGGWLPQETLELSGSRLEQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0834-Ab Anti-MRGX3/ MRGPRX3/ GPCR monoclonal antibody
    Target Antigen GM-Tg-g-MP0834-Ag MRGPRX3 VLP (virus-like particle)
    ORF Viral Vector pGMLP004680 Human GPCR Lentivirus plasmid
    ORF Viral Vector vGMLP004680 Human GPCR Lentivirus particle


    Target information

    Target ID GM-MP0834
    Target Name MRGPRX3
    Gene ID 117195
    Gene Symbol and Synonyms GPCR,MRGPRX3,MRGX3,SNSR1,SNSR2
    Uniprot Accession Q96LB0
    Uniprot Entry Name MRGX3_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000179826
    Target Classification GPCR

    This gene encodes a member of the mas-related/sensory neuron specific subfamily of G protein coupled receptors. The encoded protein may be involved in sensory neuron regulation and in the modulation of pain. [provided by RefSeq, Oct 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.