Human RARRES1/LXNL/ PERG-1 ORF/cDNA clone-Lentivirus plasmid (NM_206963)

Pre-made Human RARRES1/LXNL/ PERG-1 Lentiviral expression plasmid for RARRES1 lentivirus packaging, RARRES1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to RARRES1/LXNL products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP004777 Human RARRES1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP004777
Gene Name RARRES1
Accession Number NM_206963
Gene ID 5918
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 885 bp
Gene Alias LXNL, PERG-1, TIG1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCAGCCCCGCCGGCAACGGCTGCCTGCTCCCTGGTCCGGGCCCAGGGGCCCGCGCCCCACCGCCCCGCTGCTCGCGCTGCTGCTGTTGCTCGCCCCGGTGGCGGCGCCCGCGGGGTCCGGGGACCCCGACGACCCTGGGCAGCCTCAGGATGCTGGGGTCCCGCGCAGGCTCCTGCAGCAGGCGGCGCGCGCGGCGCTTCACTTCTTCAACTTCCGGTCCGGCTCGCCCAGCGCGCTACGAGTGCTGGCCGAGGTGCAGGAGGGCCGCGCGTGGATTAATCCAAAAGAGGGATGTAAAGTTCACGTGGTCTTCAGCACAGAGCGCTACAACCCAGAGTCTTTACTTCAGGAAGGTGAGGGACGTTTGGGGAAATGTTCTGCTCGAGTGTTTTTCAAGAATCAGAAACCCAGACCAACCATCAATGTAACTTGTACACGGCTCATCGAGAAAAAGAAAAGACAACAAGAGGATTACCTGCTTTACAAGCAAATGAAGCAACTGAAAAACCCCTTGGAAATAGTCAGCATACCTGATAATCATGGACATATTGATCCCTCTCTGAGACTCATCTGGGATTTGGCTTTCCTTGGAAGCTCTTACGTGATGTGGGAAATGACAACACAGGTGTCACACTACTACTTGGCACAGCTCACTAGTGTGAGGCAGTGGAAAACTAATGATGATACAATTGATTTTGATTATACTGTTCTACTTCATGAATTATCAACACAGGAAATAATTCCCTGTCGCATTCACTTGGTCTGGTACCCTGGCAAACCTCTTAAAGTGAAGTACCACTGTCAAGAGCTACAGACACCAGAAGAAGCCTCCGGAACTGAAGAAGGATCAGCTGTAGTACCAACAGAGCTTAGTAATTTCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1475-Ab Anti-TIG1/ RARRES1/ LXNL functional antibody
    Target Antigen GM-Tg-g-SE1475-Ag RARRES1 protein
    ORF Viral Vector pGMLP004777 Human RARRES1 Lentivirus plasmid
    ORF Viral Vector vGMLP004777 Human RARRES1 Lentivirus particle


    Target information

    Target ID GM-SE1475
    Target Name RARRES1
    Gene ID 5918, 109222, 703781, 310486, 101083955, 612298, 510102
    Gene Symbol and Synonyms 5430417P09Rik,LXNL,PERG-1,RARRES1,TIG1
    Uniprot Accession P49788
    Uniprot Entry Name TIG1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Prostate Cancer, Malignant neoplasm of bladder
    Gene Ensembl ENSG00000118849
    Target Classification Not Available

    This gene was identified as a retinoid acid (RA) receptor-responsive gene. It encodes a type 1 membrane protein. The expression of this gene is upregulated by tazarotene as well as by retinoic acid receptors. The expression of this gene is found to be downregulated in prostate cancer, which is caused by the methylation of its promoter and CpG island. Alternatively spliced transcript variant encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.