Human RARRES1/LXNL/ PERG-1 ORF/cDNA clone-Lentivirus particle (NM_206963)
Pre-made Human RARRES1/LXNL/ PERG-1 Lentiviral expression plasmid for RARRES1 lentivirus packaging, RARRES1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to RARRES1/LXNL products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004777 | Human RARRES1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004777 |
Gene Name | RARRES1 |
Accession Number | NM_206963 |
Gene ID | 5918 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 885 bp |
Gene Alias | LXNL, PERG-1, TIG1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCAGCCCCGCCGGCAACGGCTGCCTGCTCCCTGGTCCGGGCCCAGGGGCCCGCGCCCCACCGCCCCGCTGCTCGCGCTGCTGCTGTTGCTCGCCCCGGTGGCGGCGCCCGCGGGGTCCGGGGACCCCGACGACCCTGGGCAGCCTCAGGATGCTGGGGTCCCGCGCAGGCTCCTGCAGCAGGCGGCGCGCGCGGCGCTTCACTTCTTCAACTTCCGGTCCGGCTCGCCCAGCGCGCTACGAGTGCTGGCCGAGGTGCAGGAGGGCCGCGCGTGGATTAATCCAAAAGAGGGATGTAAAGTTCACGTGGTCTTCAGCACAGAGCGCTACAACCCAGAGTCTTTACTTCAGGAAGGTGAGGGACGTTTGGGGAAATGTTCTGCTCGAGTGTTTTTCAAGAATCAGAAACCCAGACCAACCATCAATGTAACTTGTACACGGCTCATCGAGAAAAAGAAAAGACAACAAGAGGATTACCTGCTTTACAAGCAAATGAAGCAACTGAAAAACCCCTTGGAAATAGTCAGCATACCTGATAATCATGGACATATTGATCCCTCTCTGAGACTCATCTGGGATTTGGCTTTCCTTGGAAGCTCTTACGTGATGTGGGAAATGACAACACAGGTGTCACACTACTACTTGGCACAGCTCACTAGTGTGAGGCAGTGGAAAACTAATGATGATACAATTGATTTTGATTATACTGTTCTACTTCATGAATTATCAACACAGGAAATAATTCCCTGTCGCATTCACTTGGTCTGGTACCCTGGCAAACCTCTTAAAGTGAAGTACCACTGTCAAGAGCTACAGACACCAGAAGAAGCCTCCGGAACTGAAGAAGGATCAGCTGTAGTACCAACAGAGCTTAGTAATTTCTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1475-Ab | Anti-TIG1/ RARRES1/ LXNL functional antibody |
Target Antigen | GM-Tg-g-SE1475-Ag | RARRES1 protein |
ORF Viral Vector | pGMLP004777 | Human RARRES1 Lentivirus plasmid |
ORF Viral Vector | vGMLP004777 | Human RARRES1 Lentivirus particle |
Target information
Target ID | GM-SE1475 |
Target Name | RARRES1 |
Gene ID | 5918, 109222, 703781, 310486, 101083955, 612298, 510102 |
Gene Symbol and Synonyms | 5430417P09Rik,LXNL,PERG-1,RARRES1,TIG1 |
Uniprot Accession | P49788 |
Uniprot Entry Name | TIG1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Prostate Cancer, Malignant neoplasm of bladder |
Gene Ensembl | ENSG00000118849 |
Target Classification | Not Available |
This gene was identified as a retinoid acid (RA) receptor-responsive gene. It encodes a type 1 membrane protein. The expression of this gene is upregulated by tazarotene as well as by retinoic acid receptors. The expression of this gene is found to be downregulated in prostate cancer, which is caused by the methylation of its promoter and CpG island. Alternatively spliced transcript variant encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.