Human IL36RN/FIL1/ FIL1(DELTA) ORF/cDNA clone-Lentivirus plasmid (NM_173170)
Pre-made Human IL36RN/FIL1/ FIL1(DELTA) Lentiviral expression plasmid for IL36RN lentivirus packaging, IL36RN lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to IL36RN/FIL1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP004790 | Human IL36RN Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP004790 |
Gene Name | IL36RN |
Accession Number | NM_173170 |
Gene ID | 26525 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 468 bp |
Gene Alias | FIL1, FIL1(DELTA), FIL1D, IL-36Ra, IL1F5, IL1HY1, IL1L1, IL1RP3, IL36RA, PSORP, PSORS14 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGTCCTGAGTGGGGCGCTGTGCTTCCGAATGAAGGACTCGGCATTGAAGGTGCTTTATCTGCATAATAACCAGCTTCTAGCTGGAGGGCTGCATGCAGGGAAGGTCATTAAAGGTGAAGAGATCAGCGTGGTCCCCAATCGGTGGCTGGATGCCAGCCTGTCCCCCGTCATCCTGGGTGTCCAGGGTGGAAGCCAGTGCCTGTCATGTGGGGTGGGGCAGGAGCCGACTCTAACACTAGAGCCAGTGAACATCATGGAGCTCTATCTTGGTGCCAAGGAATCCAAGAGCTTCACCTTCTACCGGCGGGACATGGGGCTCACCTCCAGCTTCGAGTCGGCTGCCTACCCGGGCTGGTTCCTGTGCACGGTGCCTGAAGCCGATCAGCCTGTCAGACTCACCCAGCTTCCCGAGAATGGTGGCTGGAATGCCCCCATCACAGACTTCTACTTCCAGCAGTGTGACTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-ab-532 | Pre-Made Spesolimab biosimilar, Whole mAb, Anti-IL36RN/IL-36R Antibody: Anti-FIL1/FIL1(DELTA)/FIL1D/IL1F5/IL1HY1/IL1L1/IL1RP3/IL36RA/PSORP/PSORS14 therapeutic antibody |
Target Antibody | GM-Tg-g-SE0627-Ab | Anti-I36RA/ IL36RN/ FIL1 functional antibody |
Target Antigen | GM-Tg-g-SE0627-Ag | IL36RN protein |
Cytokine | cks-Tg-g-GM-SE0627 | interleukin 36 receptor antagonist (IL36RN) protein & antibody |
ORF Viral Vector | pGMLP004790 | Human IL36RN Lentivirus plasmid |
ORF Viral Vector | pGMLP-IL-042 | Human IL36RN Lentivirus plasmid |
ORF Viral Vector | pGMAP-IL-125 | Human IL36RN Adenovirus plasmid |
ORF Viral Vector | vGMLP004790 | Human IL36RN Lentivirus particle |
ORF Viral Vector | vGMLP-IL-042 | Human IL36RN Lentivirus particle |
ORF Viral Vector | vGMAP-IL-125 | Human IL36RN Adenovirus particle |
Target information
Target ID | GM-SE0627 |
Target Name | IL36RN |
Gene ID | 26525, 54450, 705268, 311783, 611869, 518514, 100065154 |
Gene Symbol and Synonyms | FIL1,FIL1(DELTA),FIL1D,Fil1delta,If36rn,Il-1h3,IL-36Ra,IL1F5,IL1HY1,IL1L1,IL1RP3,IL36RA,IL36RN,PSORP,PSORS14 |
Uniprot Accession | Q9UBH0 |
Uniprot Entry Name | I36RA_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, INN Index, Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000136695 |
Target Classification | Not Available |
The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine was shown to specifically inhibit the activation of NF-kappaB induced by interleukin 1 family, member 6 (IL1F6). This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. Two alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.