Human DUSP15/C20orf57/VHY ORF/cDNA clone-Lentivirus plasmid (NM_001320479)

Cat. No.: pGMLP004826
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human DUSP15/C20orf57/VHY Lentiviral expression plasmid for DUSP15 lentivirus packaging, DUSP15 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to DUSP15/C20orf57 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $522
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004826
Gene Name DUSP15
Accession Number NM_001320479
Gene ID 128853
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 888 bp
Gene Alias C20orf57,VHY
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACCGAAGGGGTACTTCCTGGACTCTACCTCGGAAACTTCATTGATGCCAAAGACCTGGATCAGCTGGGCCGAAATAAGATCACACACATCATCTCTATCCATGAGTCACCCCAGCCTCTGCTGCAGGATATCACCTACCTTCGCATCCCGGTCGCTGATACCCCTGAGGTACCCATCAAAAAGCACTTCAAAGAATGTATCAACTTCATCCACTGCTGCCGCCTTAATGGGGGGAACTGCCTTGTGCACTGCTTTGCAGGCATCTCTCGCAGCACCACGATTGTGACAGCGTATGTGATGACTGTGACGGGGCTAGGCTGGCGGGACGTGCTTGAAGCCATCAAGGCCACCAGGCCCATCGCCAACCCCAACCCAGGCTTTAGGCAGCAGCTTGAAGAGTTTGGCTGGGCCAGTTCCCAGAAGGGTGCCAGACATAGGACCTCAAAAACCTCTGGTGCCCAATGCCCTCCGATGACTTCAGCAACCTGCCTGCTGGCTGCACGTGTGGCTCTTCTCTCCGCAGCGCTGGTGCGCGAAGCCACCGGGCGCACAGCCCAGCGCTGTCGTCTGAGTCCGCGGGCGGCCGCCGAGCGCCTGCTGGGGCCGCCACCTCACGTTGCAGCAGGATGGTCACCGGACCCAAAGTACCAGATCTGTCTGTGCTTCGGTGAGGAGGACCCGGGCCCCACACAGCACCCCAAGGAGCAGCTCATCATGGCGGACGTGCAGGTGCAGCTTCGGCCTGGGAGCTCGTCCTGCACTCTAAGTGCCTCAACCGAGCGCCCAGATGGGTCCTCAACCCCTGGCAACCCCGATGGCATCACTCACCTTCAATGCAGCTGCCTCCATCCTAAGCGAGCCGCTTCCTCTTCTTGTACCCGCTGA
ORF Protein Sequence MTEGVLPGLYLGNFIDAKDLDQLGRNKITHIISIHESPQPLLQDITYLRIPVADTPEVPIKKHFKECINFIHCCRLNGGNCLVHCFAGISRSTTIVTAYVMTVTGLGWRDVLEAIKATRPIANPNPGFRQQLEEFGWASSQKGARHRTSKTSGAQCPPMTSATCLLAARVALLSAALVREATGRTAQRCRLSPRAAAERLLGPPPHVAAGWSPDPKYQICLCFGEEDPGPTQHPKEQLIMADVQVQLRPGSSSCTLSASTERPDGSSTPGNPDGITHLQCSCLHPKRAASSSCTR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2090-Ab Anti-DUS15/ DUSP15/ C20orf57 monoclonal antibody
    Target Antigen GM-Tg-g-MP2090-Ag DUSP15 VLP (virus-like particle)
    ORF Viral Vector pGMLP004826 Human DUSP15 Lentivirus plasmid
    ORF Viral Vector vGMLP004826 Human DUSP15 Lentivirus particle


    Target information

    Target ID GM-MP2090
    Target Name DUSP15
    Gene ID 128853, 252864, 100431027, 362238, 111559780, 609828, 618412, 100146918
    Gene Symbol and Synonyms C20orf57,DUSP15,LMW-DSP10,T-DSP10,VHY
    Uniprot Accession Q9H1R2
    Uniprot Entry Name DUS15_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000149599
    Target Classification Not Available

    The protein encoded by this gene has both protein-tyrosine phophatase activity and serine/threonine-specific phosphatase activity, and therefore is known as a dual specificity phosphatase. This protein may function in the differentiation of oligodendrocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.