Human LYNX1 ORF/cDNA clone-Lentivirus plasmid (NM_177476)
Pre-made Human LYNX1/ Lentiviral expression plasmid for LYNX1 lentivirus packaging, LYNX1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to LYNX1/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP004856 | Human LYNX1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP004856 |
Gene Name | LYNX1 |
Accession Number | NM_177476 |
Gene ID | 66004 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 351 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGACGCCCCTGCTCACCCTGATCCTGGTGGTCCTCATGGGCTTACCTCTGGCCCAGGCCTTGGACTGCCACGTGTGTGCCTACAACGGAGACAACTGCTTCAACCCCATGCGCTGCCCGGCTATGGTTGCCTACTGCATGACCACGCGCACCTACTACACCCCCACCAGGATGAAGGTCAGTAAGTCCTGCGTGCCCCGCTGCTTCGAGACTGTGTATGATGGCTACTCCAAGCACGCGTCCACCACCTCCTGCTGCCAGTACGACCTCTGCAACGGCACCGGCCTTGCCACCCCGGCCACCCTGGCCCTGGCCCCCATCCTCCTGGCCACCCTCTGGGGTCTCCTCTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP0781-Ab | Anti-LYNX1 monoclonal antibody |
Target Antigen | GM-Tg-g-MP0781-Ag | LYNX1 VLP (virus-like particle) |
ORF Viral Vector | pGMPC001015 | Human LYNX1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP004856 | Human LYNX1 Lentivirus plasmid |
ORF Viral Vector | pGMLP005077 | Human LYNX1-SLURP2 Lentivirus plasmid |
ORF Viral Vector | vGMLP004856 | Human LYNX1 Lentivirus particle |
ORF Viral Vector | vGMLP005077 | Human LYNX1-SLURP2 Lentivirus particle |
Target information
Target ID | GM-MP0781 |
Target Name | LYNX1 |
Gene ID | 66004, 23936, 574359, 300018, 100066475 |
Gene Symbol and Synonyms | LYNX1,SLURP-2 |
Uniprot Accession | P0DP58 |
Uniprot Entry Name | LYNX1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000180155 |
Target Classification | Not Available |
This gene encodes a GPI-anchored, cell membrane bound member of the Ly6/uPAR (LU) superfamily of proteins containing the unique three-finger LU domain. This protein interacts with nicotinic acetylcholine receptors (nAChRs), and is thought to function as a modulator of nAChR activity to prevent excessive excitation. Alternatively spliced transcript variants have been found for this gene. Read-through transcription between this gene and the neighboring downstream gene (SLURP2) generates naturally-occurring transcripts (LYNX1-SLURP2) that encode a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Sep 2017]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.