Human LYNX1-SLURP2 ORF/cDNA clone-Lentivirus plasmid (NM_023946)

Pre-made Human LYNX1-SLURP2/ Lentiviral expression plasmid for LYNX1-SLURP2 lentivirus packaging, LYNX1-SLURP2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to LYNX1/LYNX1-SLURP2/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP005077 Human LYNX1-SLURP2 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP005077
Gene Name LYNX1-SLURP2
Accession Number NM_023946
Gene ID 111188157
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 396 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACGCCCCTGCTCACCCTGATCCTGGTGGTCCTCATGGGCTTACCTCTGGCCCAGGCCTTGGACTGCCACGTGTGTGCCTACAACGGAGACAACTGCTTCAACCCCATGCGCTGCCCGGCTATGGTTGCCTACTGCATGACCACGCGCACCTCTGCAGCCGAAGCCATATGGTGTCACCAGTGCACGGGCTTCGGAGGGTGCTCCCATGGATCCAGATGCCTGAGGGACTCCACCCACTGTGTCACCACTGCCACCCGGGTCCTCAGCAACACCGAGGATTTGCCTCTGGTCACCAAGATGTGCCACATAGGCTGCCCCGATATCCCCAGCCTGGGCCTGGGCCCCTACGTATCCATCGCTTGCTGCCAGACCAGCCTCTGCAACCATGACTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0781-Ab Anti-LYNX1 monoclonal antibody
    Target Antigen GM-Tg-g-MP0781-Ag LYNX1 VLP (virus-like particle)
    ORF Viral Vector pGMPC001015 Human LYNX1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP004856 Human LYNX1 Lentivirus plasmid
    ORF Viral Vector pGMLP005077 Human LYNX1-SLURP2 Lentivirus plasmid
    ORF Viral Vector vGMLP004856 Human LYNX1 Lentivirus particle
    ORF Viral Vector vGMLP005077 Human LYNX1-SLURP2 Lentivirus particle


    Target information

    Target ID GM-MP0781
    Target Name LYNX1
    Gene ID 66004, 23936, 574359, 300018, 100066475
    Gene Symbol and Synonyms LYNX1,SLURP-2
    Uniprot Accession P0DP58
    Uniprot Entry Name LYNX1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000180155
    Target Classification Not Available

    This gene encodes a GPI-anchored, cell membrane bound member of the Ly6/uPAR (LU) superfamily of proteins containing the unique three-finger LU domain. This protein interacts with nicotinic acetylcholine receptors (nAChRs), and is thought to function as a modulator of nAChR activity to prevent excessive excitation. Alternatively spliced transcript variants have been found for this gene. Read-through transcription between this gene and the neighboring downstream gene (SLURP2) generates naturally-occurring transcripts (LYNX1-SLURP2) that encode a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Sep 2017]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.