Human AQP2/AQP-CD/WCH-CD ORF/cDNA clone-Lentivirus plasmid (NM_000486)
Cat. No.: pGMLP004936
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human AQP2/AQP-CD/WCH-CD Lentiviral expression plasmid for AQP2 lentivirus packaging, AQP2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
AQP2/AQP-CD products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP004936 |
Gene Name | AQP2 |
Accession Number | NM_000486 |
Gene ID | 359 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 816 bp |
Gene Alias | AQP-CD,WCH-CD |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGTGGGAGCTCCGCTCCATAGCCTTCTCCAGGGCTGTGTTCGCAGAGTTCCTGGCCACACTCCTCTTCGTCTTCTTTGGCCTCGGCTCTGCCCTCAACTGGCCACAGGCCCTGCCCTCTGTGCTACAGATTGCCATGGCGTTTGGCTTGGGTATTGGCACCCTGGTACAGGCTCTGGGCCACATAAGCGGGGCCCACATCAACCCTGCCGTGACTGTGGCCTGCCTGGTGGGCTGCCACGTCTCCGTTCTCCGAGCCGCCTTCTACGTGGCTGCCCAGCTGCTGGGGGCTGTGGCCGGAGCCGCTCTGCTCCATGAGATCACGCCAGCAGACATCCGCGGGGACCTGGCTGTCAATGCTCTCAGCAACAGCACGACGGCTGGCCAGGCGGTGACTGTGGAGCTCTTCCTGACACTGCAGCTGGTGCTCTGCATCTTCGCCTCCACCGATGAGCGCCGCGGAGAGAACCCGGGCACCCCTGCTCTCTCCATAGGCTTCTCTGTGGCCCTGGGCCACCTCCTTGGGATCCATTACACCGGCTGCTCTATGAATCCTGCCCGCTCCCTGGCTCCAGCTGTCGTCACTGGCAAATTTGATGACCACTGGGTCTTCTGGATCGGACCCCTGGTGGGCGCCATCCTGGGCTCCCTCCTCTACAACTACGTGCTGTTTCCGCCAGCCAAGAGCCTGTCGGAGCGCCTGGCAGTGCTGAAGGGCCTGGAGCCGGACACCGATTGGGAGGAGCGCGAGGTGCGACGGCGGCAGTCGGTGGAGCTGCACTCGCCGCAGAGCCTGCCACGGGGTACCAAGGCCTGA |
ORF Protein Sequence | MWELRSIAFSRAVFAEFLATLLFVFFGLGSALNWPQALPSVLQIAMAFGLGIGTLVQALGHISGAHINPAVTVACLVGCHVSVLRAAFYVAAQLLGAVAGAALLHEITPADIRGDLAVNALSNSTTAGQAVTVELFLTLQLVLCIFASTDERRGENPGTPALSIGFSVALGHLLGIHYTGCSMNPARSLAPAVVTGKFDDHWVFWIGPLVGAILGSLLYNYVLFPPAKSLSERLAVLKGLEPDTDWEEREVRRRQSVELHSPQSLPRGTKA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP0079-Ab | Anti-AQP2/ AQP-CD/ WCH-CD monoclonal antibody |
Target Antigen | GM-Tg-g-MP0079-Ag | AQP2 VLP (virus-like particle) |
ORF Viral Vector | pGMLP004936 | Human AQP2 Lentivirus plasmid |
ORF Viral Vector | vGMLP004936 | Human AQP2 Lentivirus particle |
Target information
Target ID | GM-MP0079 |
Target Name | AQP2 |
Gene ID | 359, 11827, 711719, 25386, 101092948, 486552, 539870, 100059758 |
Gene Symbol and Synonyms | AQP-2,AQP-CD,AQP2,aqp5,aquaporin-2,cph,jpk,NDI2,WCH-CD |
Uniprot Accession | P41181 |
Uniprot Entry Name | AQP2_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Diabetes insipidus, Nephrotoxicity, Nocturnal enuresis, Renal tubulo-interstitial diseases |
Gene Ensembl | ENSG00000167580 |
Target Classification | Not Available |
This gene encodes a water channel protein located in the kidney collecting tubule. It belongs to the MIP/aquaporin family, some members of which are clustered together on chromosome 12q13. Mutations in this gene have been linked to autosomal dominant and recessive forms of nephrogenic diabetes insipidus. [provided by RefSeq, Oct 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.