Human AQP2/AQP-CD/WCH-CD ORF/cDNA clone-Lentivirus particle (NM_000486)

Cat. No.: vGMLP004936

Pre-made Human AQP2/AQP-CD/WCH-CD Lentiviral expression plasmid for AQP2 lentivirus packaging, AQP2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to AQP2/AQP-CD products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004936 Human AQP2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004936
Gene Name AQP2
Accession Number NM_000486
Gene ID 359
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 816 bp
Gene Alias AQP-CD,WCH-CD
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTGGGAGCTCCGCTCCATAGCCTTCTCCAGGGCTGTGTTCGCAGAGTTCCTGGCCACACTCCTCTTCGTCTTCTTTGGCCTCGGCTCTGCCCTCAACTGGCCACAGGCCCTGCCCTCTGTGCTACAGATTGCCATGGCGTTTGGCTTGGGTATTGGCACCCTGGTACAGGCTCTGGGCCACATAAGCGGGGCCCACATCAACCCTGCCGTGACTGTGGCCTGCCTGGTGGGCTGCCACGTCTCCGTTCTCCGAGCCGCCTTCTACGTGGCTGCCCAGCTGCTGGGGGCTGTGGCCGGAGCCGCTCTGCTCCATGAGATCACGCCAGCAGACATCCGCGGGGACCTGGCTGTCAATGCTCTCAGCAACAGCACGACGGCTGGCCAGGCGGTGACTGTGGAGCTCTTCCTGACACTGCAGCTGGTGCTCTGCATCTTCGCCTCCACCGATGAGCGCCGCGGAGAGAACCCGGGCACCCCTGCTCTCTCCATAGGCTTCTCTGTGGCCCTGGGCCACCTCCTTGGGATCCATTACACCGGCTGCTCTATGAATCCTGCCCGCTCCCTGGCTCCAGCTGTCGTCACTGGCAAATTTGATGACCACTGGGTCTTCTGGATCGGACCCCTGGTGGGCGCCATCCTGGGCTCCCTCCTCTACAACTACGTGCTGTTTCCGCCAGCCAAGAGCCTGTCGGAGCGCCTGGCAGTGCTGAAGGGCCTGGAGCCGGACACCGATTGGGAGGAGCGCGAGGTGCGACGGCGGCAGTCGGTGGAGCTGCACTCGCCGCAGAGCCTGCCACGGGGTACCAAGGCCTGA
ORF Protein Sequence MWELRSIAFSRAVFAEFLATLLFVFFGLGSALNWPQALPSVLQIAMAFGLGIGTLVQALGHISGAHINPAVTVACLVGCHVSVLRAAFYVAAQLLGAVAGAALLHEITPADIRGDLAVNALSNSTTAGQAVTVELFLTLQLVLCIFASTDERRGENPGTPALSIGFSVALGHLLGIHYTGCSMNPARSLAPAVVTGKFDDHWVFWIGPLVGAILGSLLYNYVLFPPAKSLSERLAVLKGLEPDTDWEEREVRRRQSVELHSPQSLPRGTKA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0079-Ab Anti-AQP2/ AQP-CD/ WCH-CD monoclonal antibody
    Target Antigen GM-Tg-g-MP0079-Ag AQP2 VLP (virus-like particle)
    ORF Viral Vector pGMLP004936 Human AQP2 Lentivirus plasmid
    ORF Viral Vector vGMLP004936 Human AQP2 Lentivirus particle


    Target information

    Target ID GM-MP0079
    Target Name AQP2
    Gene ID 359, 11827, 711719, 25386, 101092948, 486552, 539870, 100059758
    Gene Symbol and Synonyms AQP-2,AQP-CD,AQP2,aqp5,aquaporin-2,cph,jpk,NDI2,WCH-CD
    Uniprot Accession P41181
    Uniprot Entry Name AQP2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Diabetes insipidus, Nephrotoxicity, Nocturnal enuresis, Renal tubulo-interstitial diseases
    Gene Ensembl ENSG00000167580
    Target Classification Not Available

    This gene encodes a water channel protein located in the kidney collecting tubule. It belongs to the MIP/aquaporin family, some members of which are clustered together on chromosome 12q13. Mutations in this gene have been linked to autosomal dominant and recessive forms of nephrogenic diabetes insipidus. [provided by RefSeq, Oct 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.