Human MGMT ORF/cDNA clone-Lentivirus plasmid (NM_002412)
Pre-made Human MGMT/ Lentiviral expression plasmid for MGMT lentivirus packaging, MGMT lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to MGMT/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP004946 | Human MGMT Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP004946 |
Gene Name | MGMT |
Accession Number | NM_002412 |
Gene ID | 4255 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 717 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCTGGGACAGCCCGCGCCCCTAGAACGCTTTGCGTCCCGACGCCCGCAGGTCCTCGCGGTGCGCACCGTTTGCGACTTGGTACTTGGAAAAATGGACAAGGATTGTGAAATGAAACGCACCACACTGGACAGCCCTTTGGGGAAGCTGGAGCTGTCTGGTTGTGAGCAGGGTCTGCACGAAATAAAGCTCCTGGGCAAGGGGACGTCTGCAGCTGATGCCGTGGAGGTCCCAGCCCCCGCTGCGGTTCTCGGAGGTCCGGAGCCCCTGATGCAGTGCACAGCCTGGCTGAATGCCTATTTCCACCAGCCCGAGGCTATCGAAGAGTTCCCCGTGCCGGCTCTTCACCATCCCGTTTTCCAGCAAGAGTCGTTCACCAGACAGGTGTTATGGAAGCTGCTGAAGGTTGTGAAATTCGGAGAAGTGATTTCTTACCAGCAATTAGCAGCCCTGGCAGGCAACCCCAAAGCCGCGCGAGCAGTGGGAGGAGCAATGAGAGGCAATCCTGTCCCCATCCTCATCCCGTGCCACAGAGTGGTCTGCAGCAGCGGAGCCGTGGGCAACTACTCCGGAGGACTGGCCGTGAAGGAATGGCTTCTGGCCCATGAAGGCCACCGGTTGGGGAAGCCAGGCTTGGGAGGGAGCTCAGGTCTGGCAGGGGCCTGGCTCAAGGGAGCGGGAGCTACCTCGGGCTCCCCGCCTGCTGGCCGAAACTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T24587-Ab | Anti-MGMT monoclonal antibody |
Target Antigen | GM-Tg-g-T24587-Ag | MGMT protein |
ORF Viral Vector | pGMLV000629 | Human MGMT Lentivirus plasmid |
ORF Viral Vector | pGMLP004946 | Human MGMT Lentivirus plasmid |
ORF Viral Vector | vGMLV000629 | Human MGMT Lentivirus particle |
ORF Viral Vector | vGMLP004946 | Human MGMT Lentivirus particle |
ORF Viral Vector | pGMLV002195 | Human MGMT Lentivirus plasmid |
Target information
Target ID | GM-T24587 |
Target Name | MGMT |
Gene ID | 4255, 17314, 698134, 25332, 101085076, 442978, 616091, 100049801 |
Gene Symbol and Synonyms | Agat,AGT,MGMT |
Uniprot Accession | P16455 |
Uniprot Entry Name | MGMT_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Lung Cancer |
Gene Ensembl | ENSG00000170430 |
Target Classification | Not Available |
Alkylating agents are potent carcinogens that can result in cell death, mutation and cancer. The protein encoded by this gene is a DNA repair protein that is involved in cellular defense against mutagenesis and toxicity from alkylating agents. The protein catalyzes transfer of methyl groups from O(6)-alkylguanine and other methylated moieties of the DNA to its own molecule, which repairs the toxic lesions. Methylation of the genes promoter has been associated with several cancer types, including colorectal cancer, lung cancer, lymphoma and glioblastoma. [provided by RefSeq, Sep 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.