Human RGCC/bA157L14.2/ C13orf15 ORF/cDNA clone-Lentivirus plasmid (NM_014059)
Pre-made Human RGCC/bA157L14.2/ C13orf15 Lentiviral expression plasmid for RGCC lentivirus packaging, RGCC lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to RGCC/bA157L14.2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP004954 | Human RGCC Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP004954 |
Gene Name | RGCC |
Accession Number | NM_014059 |
Gene ID | 28984 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 414 bp |
Gene Alias | bA157L14.2, C13orf15, RGC-32, RGC32 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAAGCCGCCCGCGGCGCAGGGCAGCCCCGCGGCCGCCGCGGCCGCAGCCCCGGCCCTGGACTCGGCGGCCGCGGAGGACCTGTCGGACGCGCTGTGCGAGTTTGACGCGGTGCTGGCCGACTTCGCGTCGCCCTTCCACGAGCGCCACTTCCACTACGAGGAGCACCTGGAGCGCATGAAGCGGCGCAGCAGCGCCAGTGTCAGCGACAGCAGCGGCTTCAGCGACTCGGAGAGTGCAGATTCACTTTATAGGAACAGCTTCAGCTTCAGTGATGAAAAACTGAATTCTCCAACAGACTCTACCCCAGCTCTTCTCTCTGCCACTGTCACTCCTCAGAAAGCTAAATTAGGAGACACAAAAGAGCTAGAAGCCTTCATTGCTGATCTTGACAAAACTTTAGCAAGTATGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1444-Ab | Anti-RGCC/ C13orf15/ RGC-32 functional antibody |
Target Antigen | GM-Tg-g-SE1444-Ag | RGCC protein |
ORF Viral Vector | pGMPC000005 | Rat Rgcc Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC000046 | Rat Rgcc Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP004954 | Human RGCC Lentivirus plasmid |
ORF Viral Vector | vGMLP004954 | Human RGCC Lentivirus particle |
Target information
Target ID | GM-SE1444 |
Target Name | RGCC |
Gene ID | 28984, 66214, 698962, 117183, 101090320, 609534, 614348, 100061031 |
Gene Symbol and Synonyms | 1190002H23Rik,bA157L14.2,C12H13orf15,C13orf15,C17H13orf15,C22H13orf15,RGC-32,RGC32,RGCC |
Uniprot Accession | Q9H4X1 |
Uniprot Entry Name | RGCC_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000102760 |
Target Classification | Not Available |
This gene is thought to regulate cell cycle progression. It is induced by p53 in response to DNA damage, or by sublytic levels of complement system proteins that result in activation of the cell cycle. The encoded protein localizes to the cytoplasm during interphase and to centrosomes during mitosis. The protein forms a complex with polo-like kinase 1. The protein also translocates to the nucleus in response to treatment with complement system proteins, and can associate with and increase the kinase activity of cell division cycle 2 protein. In different assays and cell types, overexpression of this protein has been shown to activate or suppress cell cycle progression. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.