Human RGCC/bA157L14.2/ C13orf15 ORF/cDNA clone-Lentivirus particle (NM_014059)

Pre-made Human RGCC/bA157L14.2/ C13orf15 Lentiviral expression plasmid for RGCC lentivirus packaging, RGCC lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to RGCC/bA157L14.2 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004954 Human RGCC Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004954
Gene Name RGCC
Accession Number NM_014059
Gene ID 28984
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 414 bp
Gene Alias bA157L14.2, C13orf15, RGC-32, RGC32
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAGCCGCCCGCGGCGCAGGGCAGCCCCGCGGCCGCCGCGGCCGCAGCCCCGGCCCTGGACTCGGCGGCCGCGGAGGACCTGTCGGACGCGCTGTGCGAGTTTGACGCGGTGCTGGCCGACTTCGCGTCGCCCTTCCACGAGCGCCACTTCCACTACGAGGAGCACCTGGAGCGCATGAAGCGGCGCAGCAGCGCCAGTGTCAGCGACAGCAGCGGCTTCAGCGACTCGGAGAGTGCAGATTCACTTTATAGGAACAGCTTCAGCTTCAGTGATGAAAAACTGAATTCTCCAACAGACTCTACCCCAGCTCTTCTCTCTGCCACTGTCACTCCTCAGAAAGCTAAATTAGGAGACACAAAAGAGCTAGAAGCCTTCATTGCTGATCTTGACAAAACTTTAGCAAGTATGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1444-Ab Anti-RGCC/ C13orf15/ RGC-32 functional antibody
    Target Antigen GM-Tg-g-SE1444-Ag RGCC protein
    ORF Viral Vector pGMPC000005 Rat Rgcc Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000046 Rat Rgcc Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP004954 Human RGCC Lentivirus plasmid
    ORF Viral Vector vGMLP004954 Human RGCC Lentivirus particle


    Target information

    Target ID GM-SE1444
    Target Name RGCC
    Gene ID 28984, 66214, 698962, 117183, 101090320, 609534, 614348, 100061031
    Gene Symbol and Synonyms 1190002H23Rik,bA157L14.2,C12H13orf15,C13orf15,C17H13orf15,C22H13orf15,RGC-32,RGC32,RGCC
    Uniprot Accession Q9H4X1
    Uniprot Entry Name RGCC_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000102760
    Target Classification Not Available

    This gene is thought to regulate cell cycle progression. It is induced by p53 in response to DNA damage, or by sublytic levels of complement system proteins that result in activation of the cell cycle. The encoded protein localizes to the cytoplasm during interphase and to centrosomes during mitosis. The protein forms a complex with polo-like kinase 1. The protein also translocates to the nucleus in response to treatment with complement system proteins, and can associate with and increase the kinase activity of cell division cycle 2 protein. In different assays and cell types, overexpression of this protein has been shown to activate or suppress cell cycle progression. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.