Human NCR2/CD336/dJ149M18.1 ORF/cDNA clone-Lentivirus plasmid (NM_004828)

Cat. No.: pGMLP004963
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human NCR2/CD336/dJ149M18.1 Lentiviral expression plasmid for NCR2 lentivirus packaging, NCR2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to NCR2/CD336 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $507.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004963
Gene Name NCR2
Accession Number NM_004828
Gene ID 9436
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 831 bp
Gene Alias CD336,dJ149M18.1,LY95,NK-p44,NKP44
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCTGGCGAGCCCTACACCCACTGCTACTGCTGCTGCTGCTGTTCCCAGGCTCTCAGGCACAATCCAAGGCTCAGGTACTTCAAAGTGTGGCAGGGCAGACGCTAACCGTGAGATGCCAGTACCCGCCCACGGGCAGTCTCTACGAGAAGAAAGGCTGGTGTAAGGAGGCTTCAGCACTTGTGTGCATCAGGTTAGTCACCAGCTCCAAGCCCAGGACGATGGCTTGGACCTCTCGATTCACAATCTGGGACGACCCTGATGCTGGCTTCTTCACTGTCACCATGACTGATCTGAGAGAGGAAGACTCAGGACATTACTGGTGTAGAATCTACCGCCCTTCTGACAACTCTGTCTCTAAGTCCGTCAGATTCTATCTGGTGGTATCTCCAGCCTCTGCCTCCACACAGACCTCCTGGACTCCCCGCGACCTGGTCTCTTCACAGACCCAGACCCAGAGCTGTGTGCCTCCCACTGCAGGAGCCAGACAAGCCCCTGAGTCTCCATCTACCATCCCTGTCCCTTCACAGCCACAGAACTCCACGCTCCGCCCTGGCCCTGCAGCCCCCATTGCCCTGGTGCCTGTGTTCTGTGGACTCCTCGTAGCCAAGAGCCTGGTGCTGTCAGCCCTGCTCGTCTGGTGGGGGGACATATGGTGGAAAACCATGATGGAGCTCAGGAGCCTGGATACCCAAAAAGCCACCTGCCACCTTCAACAGGTCACGGACCTTCCCTGGACCTCAGTTTCCTCACCTGTAGAGAGAGAAATATTATATCACACTGTTGCAAGGACTAAGATAAGCGATGATGATGATGAACACACTTTGTGA
ORF Protein Sequence MAWRALHPLLLLLLLFPGSQAQSKAQVLQSVAGQTLTVRCQYPPTGSLYEKKGWCKEASALVCIRLVTSSKPRTMAWTSRFTIWDDPDAGFFTVTMTDLREEDSGHYWCRIYRPSDNSVSKSVRFYLVVSPASASTQTSWTPRDLVSSQTQTQSCVPPTAGARQAPESPSTIPVPSQPQNSTLRPGPAAPIALVPVFCGLLVAKSLVLSALLVWWGDIWWKTMMELRSLDTQKATCHLQQVTDLPWTSVSSPVEREILYHTVARTKISDDDDEHTL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0868-Ab Anti-NCTR2/ NCR2/ CD336 monoclonal antibody
    Target Antigen GM-Tg-g-MP0868-Ag NCR2 VLP (virus-like particle)
    ORF Viral Vector pGMLP004963 Human NCR2 Lentivirus plasmid
    ORF Viral Vector vGMLP004963 Human NCR2 Lentivirus particle


    Target information

    Target ID GM-MP0868
    Target Name NCR2
    Gene ID 9436, 693869, 101090864, 100066291
    Gene Symbol and Synonyms CD336,dJ149M18.1,LY95,NCR2,NK-p44,NKP44
    Uniprot Accession O95944
    Uniprot Entry Name NCTR2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000096264
    Target Classification Not Available

    Predicted to enable signaling receptor activity. Predicted to be involved in cellular defense response and signal transduction. Predicted to be located in plasma membrane. Predicted to be integral component of plasma membrane. Predicted to be active in cell surface. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.