Human TMEM158/BBP/p40BBP ORF/cDNA clone-Lentivirus plasmid (NM_015444)
Cat. No.: pGMLP005144
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human TMEM158/BBP/p40BBP Lentiviral expression plasmid for TMEM158 lentivirus packaging, TMEM158 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
TMEM158/BBP products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP005144 |
Gene Name | TMEM158 |
Accession Number | NM_015444 |
Gene ID | 25907 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 903 bp |
Gene Alias | BBP,p40BBP,RIS1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGCTGCCCCTGCTCGCCGCGCTCCTGGCCGCCGCCTGCCCGCTGCCGCCCGTCCGCGGCGGGGCCGCGGACGCGCCCGGCCTCCTCGGGGTGCCCTCCAATGCTTCAGTCAACGCGTCCTCCGCGGACGAGCCCATCGCCCCGCGGCTGCTGGCCTCGGCGGCCCCCGGGCCCCCCGAGCGCCCGGGCCCGGAGGAGGCGGCGGCGGCGGCGGCGCCGTGCAACATCAGCGTGCAGCGGCAGATGCTGAGCTCGCTGCTCGTGCGCTGGGGCCGCCCGCGGGGCTTCCAGTGCGACCTACTGCTCTTCTCCACCAACGCGCACGGCCGCGCTTTCTTCGCCGCCGCCTTCCACCGCGTCGGGCCGCCGCTGCTCATCGAGCACCTGGGGCTGGCGGCGGGCGGCGCGCAGCAGGACCTGCGCCTCTGCGTGGGCTGCGGCTGGGTGCGCGGTCGCCGCACCGGCCGCCTCCGGCCCGCCGCCGCCCCCAGCGCCGCCGCCGCCACCGCCGGGGCGCCCACCGCGCTGCCAGCCTACCCCGCGGCCGAGCCGCCCGGGCCGCTGTGGCTGCAGGGCGAGCCGCTGCATTTCTGCTGCCTAGACTTCAGCCTGGAGGAGCTGCAGGGCGAGCCGGGCTGGCGGCTGAACCGTAAGCCCATTGAGTCCACGCTGGTGGCCTGCTTCATGACCCTGGTCATCGTGGTGTGGAGCGTGGCCGCCCTCATCTGGCCGGTGCCCATCATCGCCGGCTTCCTGCCCAACGGCATGGAACAGCGCCGGACCACCGCCAGCACCACCGCAGCCACCCCCGCCGCAGTGCCCGCAGGGACCACCGCAGCCGCCGCCGCCGCCGCCGCTGCCGCCGCCGCCGCGGCCGTCACTTCGGGGGTGGCGACCAAGTGA |
ORF Protein Sequence | MLPLLAALLAAACPLPPVRGGAADAPGLLGVPSNASVNASSADEPIAPRLLASAAPGPPERPGPEEAAAAAAPCNISVQRQMLSSLLVRWGRPRGFQCDLLLFSTNAHGRAFFAAAFHRVGPPLLIEHLGLAAGGAQQDLRLCVGCGWVRGRRTGRLRPAAAPSAAAATAGAPTALPAYPAAEPPGPLWLQGEPLHFCCLDFSLEELQGEPGWRLNRKPIESTLVACFMTLVIVVWSVAALIWPVPIIAGFLPNGMEQRRTTASTTAATPAAVPAGTTAAAAAAAAAAAAAAVTSGVATK |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP1998-Ab | Anti-TMEM158 monoclonal antibody |
Target Antigen | GM-Tg-g-IP1998-Ag | TMEM158 protein |
ORF Viral Vector | pGMLP005144 | Human TMEM158 Lentivirus plasmid |
ORF Viral Vector | vGMLP005144 | Human TMEM158 Lentivirus particle |
Target information
Target ID | GM-IP1998 |
Target Name | TMEM158 |
Gene ID | 25907, 72309, 106996039, 117582, 111558414, 119864589, 788085, 111768353 |
Gene Symbol and Synonyms | 2310037P21Rik,BBP,p40BBP,RIS1,TMEM158 |
Uniprot Accession | Q8WZ71 |
Uniprot Entry Name | TM158_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000249992 |
Target Classification | Not Available |
Constitutive activation of the Ras pathway triggers an irreversible proliferation arrest reminiscent of replicative senescence. Transcription of this gene is upregulated in response to activation of the Ras pathway, but not under other conditions that induce senescence. The encoded protein is similar to a rat cell surface receptor proposed to function in a neuronal survival pathway. An allelic polymorphism in this gene results in both functional and non-functional (frameshifted) alleles; the reference genome represents the functional allele. [provided by RefSeq, Jul 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.