Human TMEM158/BBP/p40BBP ORF/cDNA clone-Lentivirus particle (NM_015444)

Cat. No.: vGMLP005144

Pre-made Human TMEM158/BBP/p40BBP Lentiviral expression plasmid for TMEM158 lentivirus packaging, TMEM158 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to TMEM158/BBP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP005144 Human TMEM158 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP005144
Gene Name TMEM158
Accession Number NM_015444
Gene ID 25907
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 903 bp
Gene Alias BBP,p40BBP,RIS1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGCCCCTGCTCGCCGCGCTCCTGGCCGCCGCCTGCCCGCTGCCGCCCGTCCGCGGCGGGGCCGCGGACGCGCCCGGCCTCCTCGGGGTGCCCTCCAATGCTTCAGTCAACGCGTCCTCCGCGGACGAGCCCATCGCCCCGCGGCTGCTGGCCTCGGCGGCCCCCGGGCCCCCCGAGCGCCCGGGCCCGGAGGAGGCGGCGGCGGCGGCGGCGCCGTGCAACATCAGCGTGCAGCGGCAGATGCTGAGCTCGCTGCTCGTGCGCTGGGGCCGCCCGCGGGGCTTCCAGTGCGACCTACTGCTCTTCTCCACCAACGCGCACGGCCGCGCTTTCTTCGCCGCCGCCTTCCACCGCGTCGGGCCGCCGCTGCTCATCGAGCACCTGGGGCTGGCGGCGGGCGGCGCGCAGCAGGACCTGCGCCTCTGCGTGGGCTGCGGCTGGGTGCGCGGTCGCCGCACCGGCCGCCTCCGGCCCGCCGCCGCCCCCAGCGCCGCCGCCGCCACCGCCGGGGCGCCCACCGCGCTGCCAGCCTACCCCGCGGCCGAGCCGCCCGGGCCGCTGTGGCTGCAGGGCGAGCCGCTGCATTTCTGCTGCCTAGACTTCAGCCTGGAGGAGCTGCAGGGCGAGCCGGGCTGGCGGCTGAACCGTAAGCCCATTGAGTCCACGCTGGTGGCCTGCTTCATGACCCTGGTCATCGTGGTGTGGAGCGTGGCCGCCCTCATCTGGCCGGTGCCCATCATCGCCGGCTTCCTGCCCAACGGCATGGAACAGCGCCGGACCACCGCCAGCACCACCGCAGCCACCCCCGCCGCAGTGCCCGCAGGGACCACCGCAGCCGCCGCCGCCGCCGCCGCTGCCGCCGCCGCCGCGGCCGTCACTTCGGGGGTGGCGACCAAGTGA
ORF Protein Sequence MLPLLAALLAAACPLPPVRGGAADAPGLLGVPSNASVNASSADEPIAPRLLASAAPGPPERPGPEEAAAAAAPCNISVQRQMLSSLLVRWGRPRGFQCDLLLFSTNAHGRAFFAAAFHRVGPPLLIEHLGLAAGGAQQDLRLCVGCGWVRGRRTGRLRPAAAPSAAAATAGAPTALPAYPAAEPPGPLWLQGEPLHFCCLDFSLEELQGEPGWRLNRKPIESTLVACFMTLVIVVWSVAALIWPVPIIAGFLPNGMEQRRTTASTTAATPAAVPAGTTAAAAAAAAAAAAAAVTSGVATK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1998-Ab Anti-TMEM158 monoclonal antibody
    Target Antigen GM-Tg-g-IP1998-Ag TMEM158 protein
    ORF Viral Vector pGMLP005144 Human TMEM158 Lentivirus plasmid
    ORF Viral Vector vGMLP005144 Human TMEM158 Lentivirus particle


    Target information

    Target ID GM-IP1998
    Target Name TMEM158
    Gene ID 25907, 72309, 106996039, 117582, 111558414, 119864589, 788085, 111768353
    Gene Symbol and Synonyms 2310037P21Rik,BBP,p40BBP,RIS1,TMEM158
    Uniprot Accession Q8WZ71
    Uniprot Entry Name TM158_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000249992
    Target Classification Not Available

    Constitutive activation of the Ras pathway triggers an irreversible proliferation arrest reminiscent of replicative senescence. Transcription of this gene is upregulated in response to activation of the Ras pathway, but not under other conditions that induce senescence. The encoded protein is similar to a rat cell surface receptor proposed to function in a neuronal survival pathway. An allelic polymorphism in this gene results in both functional and non-functional (frameshifted) alleles; the reference genome represents the functional allele. [provided by RefSeq, Jul 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.