Human MPP1/AAG12/DXS552E ORF/cDNA clone-Lentivirus plasmid (NM_002436.3)

Cat. No.: pGMLP005422
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MPP1/AAG12/DXS552E Lentiviral expression plasmid for MPP1 lentivirus packaging, MPP1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to MPP1/AAG12 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $692.28
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP005422
Gene Name MPP1
Accession Number NM_002436.3
Gene ID 4354
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1401 bp
Gene Alias AAG12,DXS552E,EMP55,MRG1,PEMP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACCCTCAAGGCGAGCGAGGGCGAGAGTGGGGGCAGCATGCACACGGCGCTCTCCGACCTCTACCTGGAGCATTTGCTGCAGAAGCGTAGTCGGCCAGAGGCTGTATCGCATCCATTGAATACTGTGACCGAGGACATGTACACCAACGGGTCTCCTGCCCCAGGTAGCCCTGCCCAGGTCAAGGGACAGGAGGTGCGGAAAGTGCGACTCATACAGTTTGAGAAGGTCACAGAAGAGCCCATGGGAATCACGCTGAAGCTGAATGAAAAACAGTCCTGTACGGTGGCCAGAATTCTTCATGGTGGCATGATCCATAGACAAGGCTCCCTTCACGTGGGGGATGAGATCCTAGAAATCAATGGCACAAATGTGACAAATCATTCAGTGGATCAGCTGCAGAAGGCGATGAAAGAAACCAAAGGAATGATCTCATTAAAAGTAATTCCCAACCAGCAAAGCCGTCTTCCTGCACTACAGATGTTCATGAGAGCGCAGTTTGACTATGATCCCAAAAAGGACAATCTGATCCCTTGCAAGGAGGCGGGACTGAAGTTTGCTACTGGGGACATTATCCAGATTATCAACAAGGATGACAGCAATTGGTGGCAGGGACGGGTGGAAGGCTCCTCCAAGGAGTCAGCAGGATTGATCCCTTCCCCTGAGCTGCAGGAATGGCGAGTGGCAAGTATGGCTCAGTCAGCTCCTAGCGAAGCCCCGAGCTGCAGTCCCTTTGGGAAGAAGAAGAAGTACAAAGACAAATATCTGGCCAAGCACAGCTCGATTTTTGATCAGTTGGATGTTGTTTCCTACGAGGAAGTCGTTCGGCTCCCTGCATTCAAGAGGAAGACCCTGGTGCTGATCGGAGCCAGTGGGGTGGGTCGCAGCCACATTAAGAATGCCCTGCTCAGCCAGAATCCGGAGAAGTTTGTGTACCCTGTCCCATATACAACACGGCCGCCAAGGAAGAGTGAGGAAGATGGGAAGGAGTACCACTTTATCTCAACGGAGGAGATGACGAGGAACATCTCTGCCAATGAGTTCTTGGAGTTTGGCAGCTACCAAGGCAACATGTTTGGCACCAAATTTGAAACAGTGCACCAGATCCATAAGCAGAACAAGATTGCCATCCTTGACATTGAGCCCCAGACCCTGAAAATTGTTCGGACAGCAGAACTTTCGCCTTTCATTGTGTTCATTGCACCTACTGACCAGGGCACTCAGACAGAAGCCCTGCAGCAGCTGCAGAAGGACTCTGAGGCCATCCGCAGCCAGTACGCTCACTACTTTGACCTCTCACTGGTCAATAATGGTGTTGATGAAACCCTTAAGAAATTACAAGAAGCCTTCGACCAAGCGTGCAGTTCTCCACAGTGGGTGCCTGTCTCCTGGGTTTACTAA
ORF Protein Sequence MTLKASEGESGGSMHTALSDLYLEHLLQKRSRPEAVSHPLNTVTEDMYTNGSPAPGSPAQVKGQEVRKVRLIQFEKVTEEPMGITLKLNEKQSCTVARILHGGMIHRQGSLHVGDEILEINGTNVTNHSVDQLQKAMKETKGMISLKVIPNQQSRLPALQMFMRAQFDYDPKKDNLIPCKEAGLKFATGDIIQIINKDDSNWWQGRVEGSSKESAGLIPSPELQEWRVASMAQSAPSEAPSCSPFGKKKKYKDKYLAKHSSIFDQLDVVSYEEVVRLPAFKRKTLVLIGASGVGRSHIKNALLSQNPEKFVYPVPYTTRPPRKSEEDGKEYHFISTEEMTRNISANEFLEFGSYQGNMFGTKFETVHQIHKQNKIAILDIEPQTLKIVRTAELSPFIVFIAPTDQGTQTEALQQLQKDSEAIRSQYAHYFDLSLVNNGVDETLKKLQEAFDQACSSPQWVPVSWVY

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2201-Ab Anti-EM55/ MPP1/ AAG12 monoclonal antibody
    Target Antigen GM-Tg-g-MP2201-Ag MPP1 VLP (virus-like particle)
    ORF Viral Vector pGMLP000626 Human MPP1 Lentivirus plasmid
    ORF Viral Vector pGMLP005422 Human MPP1 Lentivirus plasmid
    ORF Viral Vector vGMLP000626 Human MPP1 Lentivirus particle
    ORF Viral Vector vGMLP005422 Human MPP1 Lentivirus particle


    Target information

    Target ID GM-MP2201
    Target Name MPP1
    Gene ID 4354, 17524, 702092, 101092503, 612626, 510998, 100063094
    Gene Symbol and Synonyms 55kDa,AAG12,C130070C03Rik,DXS552E,EMP55,MPP1,MRG1,p55,PEMP
    Uniprot Accession Q00013
    Uniprot Entry Name EM55_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000130830
    Target Classification Not Available

    This gene encodes the prototype of the membrane-associated guanylate kinase (MAGUK) family proteins. MAGUKs interact with the cytoskeleton and regulate cell proliferation, signaling pathways, and intercellular junctions. The encoded protein is an extensively palmitoylated membrane phosphoprotein containing a PDZ domain, a Src homology 3 (SH3) motif, and a guanylate kinase domain. This gene product interacts with various cytoskeletal proteins and cell junctional proteins in different tissue and cell types, and may be involved in the regulation of cell shape, hair cell development, neural patterning of the retina, and apico-basal polarity and tumor suppression pathways in non-erythroid cells. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.