Human RASSF3/RASSF5 ORF/cDNA clone-Lentivirus plasmid (NM_178169.3)

Cat. No.: pGMLP005669
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human RASSF3/RASSF5 Lentiviral expression plasmid for RASSF3 lentivirus packaging, RASSF3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to RASSF3/RASSF5 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $479.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP005669
Gene Name RASSF3
Accession Number NM_178169.3
Gene ID 283349
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 717 bp
Gene Alias RASSF5
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGCAGCGGCTACAGCAGCCTGGAGGAGGACGCCGAGGACTTCTTCTTCACCGCCAGGACCTCCTTCTTCAGGAGAGCGCCCCAGGGCAAGCCCCGCTCCGGCCAACAAGATGTTGAGAAAGAGAAGGAAACCCACAGTTACCTCAGCAAAGAGGAGATCAAAGAGAAAGTTCATAAATACAACTTAGCAGTCACAGACAAGTTGAAGATGACCTTGAATTCAAATGGGATTTACACTGGCTTCATTAAAGTACAGATGGAACTCTGCAAACCTCCACAGACTTCTCCAAATTCTGGAAAACTCTCTCCCAGTAGCAATGGCTGTATGAATACACTTCATATCAGCAGCACAAACACTGTCGGGGAAGTGATCGAGGCCCTGCTCAAAAAGTTTCTCGTGACTGAGAGCCCTGCCAAGTTTGCACTTTATAAGCGTTGTCACAGGGAAGACCAAGTCTACGCCTGCAAGCTCTCAGACCGGGAACATCCACTCTACCTGCGTTTGGTAGCAGGGCCCAGAACAGACACACTTAGTTTTGTTCTTCGTGAACATGAAATTGGAGAGTGGGAAGCCTTCAGCCTTCCAGAACTACAGAATTTCTTGCGCATCTTGGACAAGGAAGAAGATGAACAGCTGCAGAACCTGAAGAGGCGCTACACAGCCTACAGGCAGAAGCTGGAAGAAGCCCTCCGTGAGGTGTGGAAGCCTGATTAA
ORF Protein Sequence MSSGYSSLEEDAEDFFFTARTSFFRRAPQGKPRSGQQDVEKEKETHSYLSKEEIKEKVHKYNLAVTDKLKMTLNSNGIYTGFIKVQMELCKPPQTSPNSGKLSPSSNGCMNTLHISSTNTVGEVIEALLKKFLVTESPAKFALYKRCHREDQVYACKLSDREHPLYLRLVAGPRTDTLSFVLREHEIGEWEAFSLPELQNFLRILDKEEDEQLQNLKRRYTAYRQKLEEALREVWKPD

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2289-Ab Anti-RASF3/ RASSF3/ RASSF5 monoclonal antibody
    Target Antigen GM-Tg-g-MP2289-Ag RASSF3 VLP (virus-like particle)
    ORF Viral Vector pGMLP005669 Human RASSF3 Lentivirus plasmid
    ORF Viral Vector pGMLP-SPh-030 Human RASSF3 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-170 Human RASSF3 Adenovirus plasmid
    ORF Viral Vector vGMLP005669 Human RASSF3 Lentivirus particle
    ORF Viral Vector vGMLP-SPh-030 Human RASSF3 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-170 Human RASSF3 Adenovirus particle


    Target information

    Target ID GM-MP2289
    Target Name RASSF3
    Gene ID 283349, 192678, 715339, 362886, 101087934, 608312, 536808, 100051721
    Gene Symbol and Synonyms RASSF3,RASSF5
    Uniprot Accession Q86WH2
    Uniprot Entry Name RASF3_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000153179
    Target Classification Not Available

    The RAS oncogene (MIM 190020) is mutated in nearly one-third of all human cancers. Members of the RAS superfamily are plasma membrane GTP-binding proteins that modulate intracellular signal transduction pathways. A subfamily of RAS effectors, including RASSF3, share a RAS association (RA) domain.[supplied by OMIM, Jul 2003]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.