Human RASSF3/RASSF5 ORF/cDNA clone-Adenovirus particle (NM_178169.3)

Cat. No.: vGMAP-SPh-170

Pre-made Human RASSF3/RASSF5 Adenovirus for RASSF3 overexpression in-vitro and in-vivo. The RASSF3 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified RASSF3-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to RASSF3/RASSF5 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP-SPh-170 Human RASSF3 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP-SPh-170
Gene Name RASSF3
Accession Number NM_178169.3
Gene ID 283349
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 717 bp
Gene Alias RASSF5
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGAGCAGCGGCTACAGCAGCCTGGAGGAGGACGCCGAGGACTTCTTCTTCACCGCCAGGACCTCCTTCTTCAGGAGAGCGCCCCAGGGCAAGCCCCGCTCCGGCCAACAAGATGTTGAGAAAGAGAAGGAAACCCACAGTTACCTCAGCAAAGAGGAGATCAAAGAGAAAGTTCATAAATACAACTTAGCAGTCACAGACAAGTTGAAGATGACCTTGAATTCAAATGGGATTTACACTGGCTTCATTAAAGTACAGATGGAACTCTGCAAACCTCCACAGACTTCTCCAAATTCTGGAAAACTCTCTCCCAGTAGCAATGGCTGTATGAATACACTTCATATCAGCAGCACAAACACTGTCGGGGAAGTGATCGAGGCCCTGCTCAAAAAGTTTCTCGTGACTGAGAGCCCTGCCAAGTTTGCACTTTATAAGCGTTGTCACAGGGAAGACCAAGTCTACGCCTGCAAGCTCTCAGACCGGGAACATCCACTCTACCTGCGTTTGGTAGCAGGGCCCAGAACAGACACACTTAGTTTTGTTCTTCGTGAACATGAAATTGGAGAGTGGGAAGCCTTCAGCCTTCCAGAACTACAGAATTTCTTGCGCATCTTGGACAAGGAAGAAGATGAACAGCTGCAGAACCTGAAGAGGCGCTACACAGCCTACAGGCAGAAGCTGGAAGAAGCCCTCCGTGAGGTGTGGAAGCCTGATTAA
ORF Protein Sequence MSSGYSSLEEDAEDFFFTARTSFFRRAPQGKPRSGQQDVEKEKETHSYLSKEEIKEKVHKYNLAVTDKLKMTLNSNGIYTGFIKVQMELCKPPQTSPNSGKLSPSSNGCMNTLHISSTNTVGEVIEALLKKFLVTESPAKFALYKRCHREDQVYACKLSDREHPLYLRLVAGPRTDTLSFVLREHEIGEWEAFSLPELQNFLRILDKEEDEQLQNLKRRYTAYRQKLEEALREVWKPD

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2289-Ab Anti-RASF3/ RASSF3/ RASSF5 monoclonal antibody
    Target Antigen GM-Tg-g-MP2289-Ag RASSF3 VLP (virus-like particle)
    ORF Viral Vector pGMLP005669 Human RASSF3 Lentivirus plasmid
    ORF Viral Vector pGMLP-SPh-030 Human RASSF3 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-170 Human RASSF3 Adenovirus plasmid
    ORF Viral Vector vGMLP005669 Human RASSF3 Lentivirus particle
    ORF Viral Vector vGMLP-SPh-030 Human RASSF3 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-170 Human RASSF3 Adenovirus particle


    Target information

    Target ID GM-MP2289
    Target Name RASSF3
    Gene ID 283349, 192678, 715339, 362886, 101087934, 608312, 536808, 100051721
    Gene Symbol and Synonyms RASSF3,RASSF5
    Uniprot Accession Q86WH2
    Uniprot Entry Name RASF3_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000153179
    Target Classification Not Available

    The RAS oncogene (MIM 190020) is mutated in nearly one-third of all human cancers. Members of the RAS superfamily are plasma membrane GTP-binding proteins that modulate intracellular signal transduction pathways. A subfamily of RAS effectors, including RASSF3, share a RAS association (RA) domain.[supplied by OMIM, Jul 2003]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.