Human PON2 ORF/cDNA clone-Lentivirus plasmid (NM_000305)
                                                               Cat. No.: pGMLV000453
 
                                                               
                                                               Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human PON2/ Lentiviral expression plasmid for PON2 lentivirus packaging, PON2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
                                                                            PON2/ products
                                                                            collection>>
(antibodies,
                                                                            antigen, VLP, mRNA, ORF viral vector, etc)
                                                                        
                                                                    
Product Description
| Catalog ID | pGMLV000453 | 
| Gene Name | PON2 | 
| Accession Number | NM_000305 | 
| Gene ID | 5445 | 
| Species | Human | 
| Product Type | Lentivirus plasmid (overexpression) | 
| Insert Length | 1065 bp | 
| Gene Alias | |
| Fluorescent Reporter | ZsGreen | 
| Mammalian Cell Selection | Puromyocin | 
| Fusion Tag | 3xflag (C-Terminal) | 
| Promoter | CMV | 
| Resistance | Amplicin | 
| ORF Nucleotide Sequence | ATGGGGCGGCTGGTGGCTGTGGGCTTGCTGGGGATCGCGCTGGCGCTCCTGGGCGAGAGGCTTCTGGCACTCAGAAATCGACTTAAAGCCTCCAGAGAAGTAGAATCTGTAGACCTTCCACACTGCCACCTGATTAAAGGAATTGAAGCTGGCTCTGAAGATATTGACATACTTCCCAATGGTCTGGCTTTTTTTAGTGTGGGTCTAAAATTCCCAGGACTCCACAGCTTTGCACCAGATAAGCCTGGAGGAATACTAATGATGGATCTAAAAGAAGAAAAACCAAGGGCACGGGAATTAAGAATCAGTCGTGGGTTTGATTTGGCCTCATTCAATCCACATGGCATCAGCACTTTCATAGACAACGATGACACAGTTTATCTCTTTGTTGTAAACCACCCAGAATTCAAGAATACAGTGGAAATTTTTAAATTTGAAGAAGCAGAAAATTCTCTGTTGCATCTGAAAACAGTCAAACATGAGCTTCTTCCAAGTGTGAATGACATCACAGCTGTTGGACCGGCACATTTCTATGCCACAAATGACCACTACTTCTCTGATCCTTTCTTAAAGTATTTAGAAACATACTTGAACTTACACTGGGCAAATGTTGTTTACTACAGTCCAAATGAAGTTAAAGTGGTAGCAGAAGGATTTGATTCAGCAAATGGGATCAATATTTCACCTGATGATAAGTATATCTATGTTGCTGACATATTGGCTCATGAAATTCATGTTTTGGAAAAACACACTAATATGAATTTAACTCAGTTGAAGGTACTTGAGCTGGATACACTGGTGGATAATTTATCTATTGATCCTTCCTCGGGGGACATCTGGGTAGGCTGTCATCCTAATGGCCAGAAGCTCTTCGTGTATGACCCGAACAATCCTCCCTCGTCAGAGGTTCTCCGCATCCAGAACATTCTATCTGAGAAGCCTACAGTGACTACAGTTTATGCCAACAATGGGTCTGTTCTCCAAGGAAGTTCTGTAGCCTCAGTGTATGATGGGAAGCTGCTCATAGGCACTTTATACCACAGAGCCTTGTATTGTGAACTCTAA | 
| ORF Protein Sequence | MGRLVAVGLLGIALALLGERLLALRNRLKASREVESVDLPHCHLIKGIEAGSEDIDILPNGLAFFSVGLKFPGLHSFAPDKPGGILMMDLKEEKPRARELRISRGFDLASFNPHGISTFIDNDDTVYLFVVNHPEFKNTVEIFKFEEAENSLLHLKTVKHELLPSVNDITAVGPAHFYATNDHYFSDPFLKYLETYLNLHWANVVYYSPNEVKVVAEGFDSANGINISPDDKYIYVADILAHEIHVLEKHTNMNLTQLKVLELDTLVDNLSIDPSSGDIWVGCHPNGQKLFVYDPNNPPSSEVLRIQNILSEKPTVTTVYANNGSVLQGSSVASVYDGKLLIGTLYHRALYCEL | 
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name | 
|---|---|---|
| Target Antibody | GM-Tg-g-MP1398-Ab | Anti-PON2 monoclonal antibody | 
| Target Antigen | GM-Tg-g-MP1398-Ag | PON2 VLP (virus-like particle) | 
| ORF Viral Vector | pGMLV000453 | Human PON2 Lentivirus plasmid | 
| ORF Viral Vector | vGMLV000453 | Human PON2 Lentivirus particle | 
Target information
| Target ID | GM-MP1398 | 
| Target Name | PON2 | 
| Gene ID | 5445, 330260, 699107, 296851, 101094492, 403855, 281417, 100062686 | 
| Gene Symbol and Synonyms | 6330405I24Rik,PON2 | 
| Uniprot Accession | Q15165 | 
| Uniprot Entry Name | PON2_HUMAN | 
| Protein Sub-location | Transmembrane Protein | 
| Category | Not Available | 
| Disease | Not Available | 
| Gene Ensembl | ENSG00000105854 | 
| Target Classification | Not Available | 
This gene encodes a member of the paraoxonase gene family, which includes three known members located adjacent to each other on the long arm of chromosome 7. The encoded protein is ubiquitously expressed in human tissues, membrane-bound, and may act as a cellular antioxidant, protecting cells from oxidative stress. Hydrolytic activity against acylhomoserine lactones, important bacterial quorum-sensing mediators, suggests the encoded protein may also play a role in defense responses to pathogenic bacteria. Mutations in this gene may be associated with vascular disease and a number of quantitative phenotypes related to diabetes. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
                
                
            
        
        
                                                            

