Human PON2 ORF/cDNA clone-Lentivirus plasmid (NM_000305)

Cat. No.: pGMLV000453
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PON2/ Lentiviral expression plasmid for PON2 lentivirus packaging, PON2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to PON2/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $598.2
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV000453
Gene Name PON2
Accession Number NM_000305
Gene ID 5445
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1065 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGGCGGCTGGTGGCTGTGGGCTTGCTGGGGATCGCGCTGGCGCTCCTGGGCGAGAGGCTTCTGGCACTCAGAAATCGACTTAAAGCCTCCAGAGAAGTAGAATCTGTAGACCTTCCACACTGCCACCTGATTAAAGGAATTGAAGCTGGCTCTGAAGATATTGACATACTTCCCAATGGTCTGGCTTTTTTTAGTGTGGGTCTAAAATTCCCAGGACTCCACAGCTTTGCACCAGATAAGCCTGGAGGAATACTAATGATGGATCTAAAAGAAGAAAAACCAAGGGCACGGGAATTAAGAATCAGTCGTGGGTTTGATTTGGCCTCATTCAATCCACATGGCATCAGCACTTTCATAGACAACGATGACACAGTTTATCTCTTTGTTGTAAACCACCCAGAATTCAAGAATACAGTGGAAATTTTTAAATTTGAAGAAGCAGAAAATTCTCTGTTGCATCTGAAAACAGTCAAACATGAGCTTCTTCCAAGTGTGAATGACATCACAGCTGTTGGACCGGCACATTTCTATGCCACAAATGACCACTACTTCTCTGATCCTTTCTTAAAGTATTTAGAAACATACTTGAACTTACACTGGGCAAATGTTGTTTACTACAGTCCAAATGAAGTTAAAGTGGTAGCAGAAGGATTTGATTCAGCAAATGGGATCAATATTTCACCTGATGATAAGTATATCTATGTTGCTGACATATTGGCTCATGAAATTCATGTTTTGGAAAAACACACTAATATGAATTTAACTCAGTTGAAGGTACTTGAGCTGGATACACTGGTGGATAATTTATCTATTGATCCTTCCTCGGGGGACATCTGGGTAGGCTGTCATCCTAATGGCCAGAAGCTCTTCGTGTATGACCCGAACAATCCTCCCTCGTCAGAGGTTCTCCGCATCCAGAACATTCTATCTGAGAAGCCTACAGTGACTACAGTTTATGCCAACAATGGGTCTGTTCTCCAAGGAAGTTCTGTAGCCTCAGTGTATGATGGGAAGCTGCTCATAGGCACTTTATACCACAGAGCCTTGTATTGTGAACTCTAA
ORF Protein Sequence MGRLVAVGLLGIALALLGERLLALRNRLKASREVESVDLPHCHLIKGIEAGSEDIDILPNGLAFFSVGLKFPGLHSFAPDKPGGILMMDLKEEKPRARELRISRGFDLASFNPHGISTFIDNDDTVYLFVVNHPEFKNTVEIFKFEEAENSLLHLKTVKHELLPSVNDITAVGPAHFYATNDHYFSDPFLKYLETYLNLHWANVVYYSPNEVKVVAEGFDSANGINISPDDKYIYVADILAHEIHVLEKHTNMNLTQLKVLELDTLVDNLSIDPSSGDIWVGCHPNGQKLFVYDPNNPPSSEVLRIQNILSEKPTVTTVYANNGSVLQGSSVASVYDGKLLIGTLYHRALYCEL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1398-Ab Anti-PON2 monoclonal antibody
    Target Antigen GM-Tg-g-MP1398-Ag PON2 VLP (virus-like particle)
    ORF Viral Vector pGMLV000453 Human PON2 Lentivirus plasmid
    ORF Viral Vector vGMLV000453 Human PON2 Lentivirus particle


    Target information

    Target ID GM-MP1398
    Target Name PON2
    Gene ID 5445, 330260, 699107, 296851, 101094492, 403855, 281417, 100062686
    Gene Symbol and Synonyms 6330405I24Rik,PON2
    Uniprot Accession Q15165
    Uniprot Entry Name PON2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000105854
    Target Classification Not Available

    This gene encodes a member of the paraoxonase gene family, which includes three known members located adjacent to each other on the long arm of chromosome 7. The encoded protein is ubiquitously expressed in human tissues, membrane-bound, and may act as a cellular antioxidant, protecting cells from oxidative stress. Hydrolytic activity against acylhomoserine lactones, important bacterial quorum-sensing mediators, suggests the encoded protein may also play a role in defense responses to pathogenic bacteria. Mutations in this gene may be associated with vascular disease and a number of quantitative phenotypes related to diabetes. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.