Human UBE2D3/E2(17)KB3/ UBC4/5 ORF/cDNA clone-Lentivirus plasmid (NM_181891.3)

Pre-made Human UBE2D3/E2(17)KB3/ UBC4/5 Lentiviral expression plasmid for UBE2D3 lentivirus packaging, UBE2D3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to UBE2D3/E2(17)KB3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLV000898 Human UBE2D3 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLV000898
Gene Name UBE2D3
Accession Number NM_181891.3
Gene ID 7323
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 444 bp
Gene Alias E2(17)KB3, UBC4/5, UBCH5C
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocinmyocin
Fusion Tag Null
Promoter CMV
Resistance Amplicin
Sequence ATGGCGCTGAAACGGATTAATAAGGAACTTAGTGATTTGGCCCGTGACCCTCCAGCACAATGTTCTGCAGGTCCAGTTGGGGATGATATGTTTCATTGGCAAGCCACAATTATGGGACCTAATGACAGCCCATATCAAGGCGGTGTATTCTTTTTGACAATTCATTTTCCTACAGACTACCCCTTCAAACCACCTAAGGTTGCATTTACAACAAGAATTTATCATCCAAATATTAACAGTAATGGCAGCATTTGTCTCGATATTCTAAGATCACAGTGGTCGCCTGCTTTAACAATTTCTAAAGTTCTTTTATCCATTTGTTCACTGCTATGTGATCCAAACCCAGATGACCCCCTAGTGCCAGAGATTGCACGGATCTATAAAACAGACAGAGATAAGTACAACAGAATATCTCGGGAATGGACTCAGAAGTATGCCATGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2373-Ab Anti-UB2D3/ UBE2D3/ E2(17)KB3 monoclonal antibody
    Target Antigen GM-Tg-g-MP2373-Ag UBE2D3 VLP (virus-like particle)
    ORF Viral Vector pGMLV000898 Human UBE2D3 Lentivirus plasmid
    ORF Viral Vector pGMAD000155 Human UBE2D3 Adenovirus plasmid
    ORF Viral Vector vGMLV000898 Human UBE2D3 Lentivirus particle
    ORF Viral Vector vGMAD000155 Human UBE2D3 Adenovirus particle


    Target information

    Target ID GM-MP2373
    Target Name UBE2D3
    Gene ID 7323, 66105, 710772, 81920, 101094845, 478495, 326583, 100630481
    Gene Symbol and Synonyms 1100001F19Rik,9430029A22Rik,E2(17)KB3,UBC4/5,UBCH5C,UBE2D3,UBE2D3P
    Uniprot Accession P61077
    Uniprot Entry Name UB2D3_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000109332
    Target Classification Not Available

    The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme functions in the ubiquitination of the tumor-suppressor protein p53, which is induced by an E3 ubiquitin-protein ligase. [provided by RefSeq, Jan 2017]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.