Human UBE2D3/E2(17)KB3/ UBC4/5 ORF/cDNA clone-Lentivirus plasmid (NM_181891.3)
Pre-made Human UBE2D3/E2(17)KB3/ UBC4/5 Lentiviral expression plasmid for UBE2D3 lentivirus packaging, UBE2D3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to UBE2D3/E2(17)KB3 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLV000898 | Human UBE2D3 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLV000898 |
Gene Name | UBE2D3 |
Accession Number | NM_181891.3 |
Gene ID | 7323 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 444 bp |
Gene Alias | E2(17)KB3, UBC4/5, UBCH5C |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocinmyocin |
Fusion Tag | Null |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCGCTGAAACGGATTAATAAGGAACTTAGTGATTTGGCCCGTGACCCTCCAGCACAATGTTCTGCAGGTCCAGTTGGGGATGATATGTTTCATTGGCAAGCCACAATTATGGGACCTAATGACAGCCCATATCAAGGCGGTGTATTCTTTTTGACAATTCATTTTCCTACAGACTACCCCTTCAAACCACCTAAGGTTGCATTTACAACAAGAATTTATCATCCAAATATTAACAGTAATGGCAGCATTTGTCTCGATATTCTAAGATCACAGTGGTCGCCTGCTTTAACAATTTCTAAAGTTCTTTTATCCATTTGTTCACTGCTATGTGATCCAAACCCAGATGACCCCCTAGTGCCAGAGATTGCACGGATCTATAAAACAGACAGAGATAAGTACAACAGAATATCTCGGGAATGGACTCAGAAGTATGCCATGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP2373-Ab | Anti-UB2D3/ UBE2D3/ E2(17)KB3 monoclonal antibody |
Target Antigen | GM-Tg-g-MP2373-Ag | UBE2D3 VLP (virus-like particle) |
ORF Viral Vector | pGMLV000898 | Human UBE2D3 Lentivirus plasmid |
ORF Viral Vector | pGMAD000155 | Human UBE2D3 Adenovirus plasmid |
ORF Viral Vector | vGMLV000898 | Human UBE2D3 Lentivirus particle |
ORF Viral Vector | vGMAD000155 | Human UBE2D3 Adenovirus particle |
Target information
Target ID | GM-MP2373 |
Target Name | UBE2D3 |
Gene ID | 7323, 66105, 710772, 81920, 101094845, 478495, 326583, 100630481 |
Gene Symbol and Synonyms | 1100001F19Rik,9430029A22Rik,E2(17)KB3,UBC4/5,UBCH5C,UBE2D3,UBE2D3P |
Uniprot Accession | P61077 |
Uniprot Entry Name | UB2D3_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000109332 |
Target Classification | Not Available |
The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme functions in the ubiquitination of the tumor-suppressor protein p53, which is induced by an E3 ubiquitin-protein ligase. [provided by RefSeq, Jan 2017]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.