Human TMSB4X/FX/ PTMB4 ORF/cDNA clone-Lentivirus plasmid (NM_021109.3)

Pre-made Human TMSB4X/FX/ PTMB4 Lentiviral expression plasmid for TMSB4X lentivirus packaging, TMSB4X lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to TMSB4X/FX products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLV001370 Human TMSB4X Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLV001370
Gene Name TMSB4X
Accession Number NM_021109.3
Gene ID 7114
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 135 bp
Gene Alias FX, PTMB4, TB4X, TMSB4
Fluorescent Reporter mCherry
Mammalian Cell Selection Puromyocinmyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTCTGACAAACCCGATATGGCTGAGATCGAGAAATTCGATAAGTCGAAACTGAAGAAGACAGAGACGCAAGAGAAAAATCCACTGCCTTCCAAAGAAACGATTGAACAGGAGAAGCAAGCAGGCGAATCGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T85005-Ab Anti-TMSB4X monoclonal antibody
    Target Antigen GM-Tg-g-T85005-Ag TMSB4X protein
    ORF Viral Vector pGMLV000075 Human TMSB4X Lentivirus plasmid
    ORF Viral Vector pGMLV001370 Human TMSB4X Lentivirus plasmid
    ORF Viral Vector pGMLP003137 Human TMSB4X Lentivirus plasmid
    ORF Viral Vector vGMLV000075 Human TMSB4X Lentivirus particle
    ORF Viral Vector vGMLV001370 Human TMSB4X Lentivirus particle
    ORF Viral Vector vGMLP003137 Human TMSB4X Lentivirus particle


    Target information

    Target ID GM-T85005
    Target Name TMSB4X
    Gene ID 7114, 19241, 710959, 81814, 101088815, 100684977, 282386, 100034015
    Gene Symbol and Synonyms FX,PTMB4,Tb4,TB4X,Tbeta4,THYB4,TMSB4,TMSB4X
    Uniprot Accession P62328
    Uniprot Entry Name TYB4_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000205542
    Target Classification Not Available

    This gene encodes an actin sequestering protein which plays a role in regulation of actin polymerization. The protein is also involved in cell proliferation, migration, and differentiation. This gene escapes X inactivation and has a homolog on chromosome Y. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.