Human TMSB4X/FX/ PTMB4 ORF/cDNA clone-Lentivirus particle (NM_021109.3)
Pre-made Human TMSB4X/FX/ PTMB4 Lentiviral expression plasmid for TMSB4X lentivirus packaging, TMSB4X lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to TMSB4X/FX products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLV001370 | Human TMSB4X Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLV001370 |
Gene Name | TMSB4X |
Accession Number | NM_021109.3 |
Gene ID | 7114 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 135 bp |
Gene Alias | FX, PTMB4, TB4X, TMSB4 |
Fluorescent Reporter | mCherry |
Mammalian Cell Selection | Puromyocinmyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTCTGACAAACCCGATATGGCTGAGATCGAGAAATTCGATAAGTCGAAACTGAAGAAGACAGAGACGCAAGAGAAAAATCCACTGCCTTCCAAAGAAACGATTGAACAGGAGAAGCAAGCAGGCGAATCGTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T85005-Ab | Anti-TMSB4X monoclonal antibody |
Target Antigen | GM-Tg-g-T85005-Ag | TMSB4X protein |
ORF Viral Vector | pGMLV000075 | Human TMSB4X Lentivirus plasmid |
ORF Viral Vector | pGMLV001370 | Human TMSB4X Lentivirus plasmid |
ORF Viral Vector | pGMLP003137 | Human TMSB4X Lentivirus plasmid |
ORF Viral Vector | vGMLV000075 | Human TMSB4X Lentivirus particle |
ORF Viral Vector | vGMLV001370 | Human TMSB4X Lentivirus particle |
ORF Viral Vector | vGMLP003137 | Human TMSB4X Lentivirus particle |
Target information
Target ID | GM-T85005 |
Target Name | TMSB4X |
Gene ID | 7114, 19241, 710959, 81814, 101088815, 100684977, 282386, 100034015 |
Gene Symbol and Synonyms | FX,PTMB4,Tb4,TB4X,Tbeta4,THYB4,TMSB4,TMSB4X |
Uniprot Accession | P62328 |
Uniprot Entry Name | TYB4_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000205542 |
Target Classification | Not Available |
This gene encodes an actin sequestering protein which plays a role in regulation of actin polymerization. The protein is also involved in cell proliferation, migration, and differentiation. This gene escapes X inactivation and has a homolog on chromosome Y. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.