Human GATA4/ASD2/ TACHD ORF/cDNA clone-Lentivirus plasmid (NM_002052)
Pre-made Human GATA4/ASD2/ TACHD Lentiviral expression plasmid for GATA4 lentivirus packaging, GATA4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to GATA4/ASD2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLV001507 | Human GATA4 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLV001507 |
Gene Name | GATA4 |
Accession Number | NM_002052 |
Gene ID | 2626 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1329 bp |
Gene Alias | ASD2, TACHD, TOF, VSD1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocinmyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTATCAGAGCTTGGCCATGGCCGCCAACCACGGGCCGCCCCCCGGTGCCTACGAGGCGGGCGGCCCCGGCGCCTTCATGCACGGCGCGGGCGCCGCGTCCTCGCCAGTCTACGTGCCCACACCGCGGGTGCCCTCCTCCGTGCTGGGCCTGTCCTACCTCCAGGGCGGAGGCGCGGGCTCTGCGTCCGGAGGCGCCTCGGGCGGCAGCTCCGGTGGGGCCGCGTCTGGTGCGGGGCCCGGGACCCAGCAGGGCAGCCCGGGATGGAGCCAGGCGGGAGCCGACGGAGCCGCTTACACCCCGCCGCCGGTGTCGCCGCGCTTCTCCTTCCCGGGGACCACCGGGTCCCTGGCGGCCGCCGCCGCCGCTGCCGCGGCCCGGGAAGCTGCGGCCTACAGCAGTGGCGGCGGAGCGGCGGGTGCGGGCCTGGCGGGCCGCGAGCAGTACGGGCGCGCCGGCTTCGCGGGCTCCTACTCCAGCCCCTACCCGGCTTACATGGCCGACGTGGGCGCGTCCTGGGCCGCAGCCGCCGCCGCCTCCGCCGGCCCCTTCGACAGCCCGGTCCTGCACAGCCTGCCCGGCCGGGCCAACCCGGCCGCCCGACACCCCAATCTCGATATGTTTGACGACTTCTCAGAAGGCAGAGAGTGTGTCAACTGTGGGGCTATGTCCACCCCGCTCTGGAGGCGAGATGGGACGGGTCACTATCTGTGCAACGCCTGCGGCCTCTACCACAAGATGAACGGCATCAACCGGCCGCTCATCAAGCCTCAGCGCCGGCTGTCCGCCTCCCGCCGAGTGGGCCTCTCCTGTGCCAACTGCCAGACCACCACCACCACGCTGTGGCGCCGCAATGCGGAGGGCGAGCCTGTGTGCAATGCCTGCGGCCTCTACATGAAGCTCCACGGGGTCCCCAGGCCTCTTGCAATGCGGAAAGAGGGGATCCAAACCAGAAAACGGAAGCCCAAGAACCTGAATAAATCTAAGACACCAGCAGCTCCTTCAGGCAGTGAGAGCCTTCCTCCCGCCAGCGGTGCTTCCAGCAACTCCAGCAACGCCACCACCAGCAGCAGCGAGGAGATGCGTCCCATCAAGACGGAGCCTGGCCTGTCATCTCACTACGGGCACAGCAGCTCCGTGTCCCAGACGTTCTCAGTCAGTGCGATGTCTGGCCATGGGCCCTCCATCCACCCTGTCCTCTCGGCCCTGAAGCTCTCCCCACAAGGCTATGCGTCTCCCGTCAGCCAGTCTCCACAGACCAGCTCCAAGCAGGACTCTTGGAACAGCCTGGTCTTGGCCGACAGTCACGGGGACATAATCACTGCGTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T51817-Ab | Anti-GATA4 monoclonal antibody |
Target Antigen | GM-Tg-g-T51817-Ag | GATA4 protein |
ORF Viral Vector | pGMLV000028 | Rat Gata4 Lentivirus plasmid |
ORF Viral Vector | pGMLV000960 | Human GATA4 Lentivirus plasmid |
ORF Viral Vector | pGMLV001046 | Human GATA4 Lentivirus plasmid |
ORF Viral Vector | pGMLV001507 | Human GATA4 Lentivirus plasmid |
ORF Viral Vector | pGMAD000115 | Human GATA4 Adenovirus plasmid |
ORF Viral Vector | pGMAAV000160 | Rat Gata4 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMPC000662 | Human GATA4 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLV000028 | Rat Gata4 Lentivirus particle |
ORF Viral Vector | vGMLV000960 | Human GATA4 Lentivirus particle |
ORF Viral Vector | vGMLV001046 | Human GATA4 Lentivirus particle |
ORF Viral Vector | vGMLV001507 | Human GATA4 Lentivirus particle |
ORF Viral Vector | vGMAD000115 | Human GATA4 Adenovirus particle |
ORF Viral Vector | vGMAAV000160 | Rat Gata4 Adeno-associate virus(AAV) particle |
ORF Viral Vector | pGMLV002504 | Human GATA4 Lentivirus plasmid |
Target information
Target ID | GM-T51817 |
Target Name | GATA4 |
Gene ID | 2626, 14463, 696775, 54254, 101086140, 486079, 327716, 100065126 |
Gene Symbol and Synonyms | ASD2,Gata-4,GATA4,TACHD,TOF,VSD1 |
Uniprot Accession | P43694 |
Uniprot Entry Name | GATA4_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Head and Neck Cancer |
Gene Ensembl | ENSG00000136574 |
Target Classification | Not Available |
This gene encodes a member of the GATA family of zinc-finger transcription factors. Members of this family recognize the GATA motif which is present in the promoters of many genes. This protein is thought to regulate genes involved in embryogenesis and in myocardial differentiation and function, and is necessary for normal testicular development. Mutations in this gene have been associated with cardiac septal defects. Additionally, alterations in gene expression have been associated with several cancer types. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.