Human GATA4/ASD2/ TACHD ORF/cDNA clone-Lentivirus plasmid (NM_001308093.1)

Pre-made Human GATA4/ASD2/ TACHD Lentiviral expression plasmid for GATA4 lentivirus packaging, GATA4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to GATA4/ASD2 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLV001046 Human GATA4 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLV001046
Gene Name GATA4
Accession Number NM_001308093.1
Gene ID 2626
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1332 bp
Gene Alias ASD2, TACHD, TOF, VSD1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocinmyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTATCAGAGCTTGGCCATGGCCGCCAACCACGGGCCGCCCCCCGGTGCCTACGAGGCGGGCGGCCCCGGCGCCTTCATGCACGGCGCGGGCGCCGCGTCCTCGCCAGTCTACGTGCCCACACCGCGGGTGCCCTCCTCCGTGCTGGGCCTGTCCTACCTCCAGGGCGGAGGCGCGGGCTCTGCGTCCGGAGGCGCCTCGGGCGGCAGCTCCGGTGGGGCCGCGTCTGGTGCGGGGCCCGGGACCCAGCAGGGCAGCCCGGGATGGAGCCAGGCGGGAGCCGACGGAGCCGCTTACACCCCGCCGCCGGTGTCGCCGCGCTTCTCCTTCCCGGGGACCACCGGGTCCCTGGCGGCCGCCGCCGCCGCTGCCGCGGCCCGGGAAGCTGCGGCCTACAGCAGTGGCGGCGGAGCGGCGGGTGCGGGCCTGGCGGGCCGCGAGCAGTACGGGCGCGCCGGCTTCGCGGGCTCCTACTCCAGCCCCTACCCGGCTTACATGGCCGACGTGGGCGCGTCCTGGGCCGCAGCCGCCGCCGCCTCCGCCGGCCCCTTCGACAGCCCGGTCCTGCACAGCCTGCCCGGCCGGGCCAACCCGGCCGCCCGACACCCCAATCTCGTAGATATGTTTGACGACTTCTCAGAAGGCAGAGAGTGTGTCAACTGTGGGGCTATGTCCACCCCGCTCTGGAGGCGAGATGGGACGGGTCACTATCTGTGCAACGCCTGCGGCCTCTACCACAAGATGAACGGCATCAACCGGCCGCTCATCAAGCCTCAGCGCCGGCTGTCCGCCTCCCGCCGAGTGGGCCTCTCCTGTGCCAACTGCCAGACCACCACCACCACGCTGTGGCGCCGCAATGCGGAGGGCGAGCCTGTGTGCAATGCCTGCGGCCTCTACATGAAGCTCCACGGGGTCCCCAGGCCTCTTGCAATGCGGAAAGAGGGGATCCAAACCAGAAAACGGAAGCCCAAGAACCTGAATAAATCTAAGACACCAGCAGCTCCTTCAGGCAGTGAGAGCCTTCCTCCCGCCAGCGGTGCTTCCAGCAACTCCAGCAACGCCACCACCAGCAGCAGCGAGGAGATGCGTCCCATCAAGACGGAGCCTGGCCTGTCATCTCACTACGGGCACAGCAGCTCCGTGTCCCAGACGTTCTCAGTCAGTGCGATGTCTGGCCATGGGCCCTCCATCCACCCTGTCCTCTCGGCCCTGAAGCTCTCCCCACAAGGCTATGCGTCTCCCGTCAGCCAGTCTCCACAGACCAGCTCCAAGCAGGACTCTTGGAACAGCCTGGTCTTGGCCGACAGTCACGGGGACATAATCACTGCGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T51817-Ab Anti-GATA4 monoclonal antibody
    Target Antigen GM-Tg-g-T51817-Ag GATA4 protein
    ORF Viral Vector pGMLV000028 Rat Gata4 Lentivirus plasmid
    ORF Viral Vector pGMLV000960 Human GATA4 Lentivirus plasmid
    ORF Viral Vector pGMLV001046 Human GATA4 Lentivirus plasmid
    ORF Viral Vector pGMLV001507 Human GATA4 Lentivirus plasmid
    ORF Viral Vector pGMAD000115 Human GATA4 Adenovirus plasmid
    ORF Viral Vector pGMAAV000160 Rat Gata4 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMPC000662 Human GATA4 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000028 Rat Gata4 Lentivirus particle
    ORF Viral Vector vGMLV000960 Human GATA4 Lentivirus particle
    ORF Viral Vector vGMLV001046 Human GATA4 Lentivirus particle
    ORF Viral Vector vGMLV001507 Human GATA4 Lentivirus particle
    ORF Viral Vector vGMAD000115 Human GATA4 Adenovirus particle
    ORF Viral Vector vGMAAV000160 Rat Gata4 Adeno-associate virus(AAV) particle
    ORF Viral Vector pGMLV002504 Human GATA4 Lentivirus plasmid


    Target information

    Target ID GM-T51817
    Target Name GATA4
    Gene ID 2626, 14463, 696775, 54254, 101086140, 486079, 327716, 100065126
    Gene Symbol and Synonyms ASD2,Gata-4,GATA4,TACHD,TOF,VSD1
    Uniprot Accession P43694
    Uniprot Entry Name GATA4_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Head and Neck Cancer
    Gene Ensembl ENSG00000136574
    Target Classification Not Available

    This gene encodes a member of the GATA family of zinc-finger transcription factors. Members of this family recognize the GATA motif which is present in the promoters of many genes. This protein is thought to regulate genes involved in embryogenesis and in myocardial differentiation and function, and is necessary for normal testicular development. Mutations in this gene have been associated with cardiac septal defects. Additionally, alterations in gene expression have been associated with several cancer types. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.