Human CD55/CHAPLE/ CR ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_000574.4)

Pre-made Human CD55/CHAPLE/ CR Non-Viral expression plasmid (overexpression vector) for mouse CD55 overexpression in unique cell transient transfection and stable cell line development.

Target products collectionGo to CD55/CHAPLE products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMPC000098 Human CD55 Mammalian (Non-Viral Vector) plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMPC000098
Gene Name CD55
Accession Number NM_000574.4
Gene ID 1604
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 1146 bp
Gene Alias CHAPLE, CR, CROM, DAF, TC
Fluorescent Reporter
Mammalian Cell Selection Puromyocin
Fusion Tag Null
Promoter CMV
Resistance Amplicin
Sequence ATGACCGTCGCGCGGCCGAGCGTGCCCGCGGCGCTGCCCCTCCTCGGGGAGCTGCCCCGGCTGCTGCTGCTGGTGCTGTTGTGCCTGCCGGCCGTGTGGGGTGACTGTGGCCTTCCCCCAGATGTACCTAATGCCCAGCCAGCTTTGGAAGGCCGTACAAGTTTTCCCGAGGATACTGTAATAACGTACAAATGTGAAGAAAGCTTTGTGAAAATTCCTGGCGAGAAGGACTCAGTGATCTGCCTTAAGGGCAGTCAATGGTCAGATATTGAAGAGTTCTGCAATCGTAGCTGCGAGGTGCCAACAAGGCTAAATTCTGCATCCCTCAAACAGCCTTATATCACTCAGAATTATTTTCCAGTCGGTACTGTTGTGGAATATGAGTGCCGTCCAGGTTACAGAAGAGAACCTTCTCTATCACCAAAACTAACTTGCCTTCAGAATTTAAAATGGTCCACAGCAGTCGAATTTTGTAAAAAGAAATCATGCCCTAATCCGGGAGAAATACGAAATGGTCAGATTGATGTACCAGGTGGCATATTATTTGGTGCAACCATCTCCTTCTCATGTAACACAGGGTACAAATTATTTGGCTCGACTTCTAGTTTTTGTCTTATTTCAGGCAGCTCTGTCCAGTGGAGTGACCCGTTGCCAGAGTGCAGAGAAATTTATTGTCCAGCACCACCACAAATTGACAATGGAATAATTCAAGGGGAACGTGACCATTATGGATATAGACAGTCTGTAACGTATGCATGTAATAAAGGATTCACCATGATTGGAGAGCACTCTATTTATTGTACTGTGAATAATGATGAAGGAGAGTGGAGTGGCCCACCACCTGAATGCAGAGGAAAATCTCTAACTTCCAAGGTCCCACCAACAGTTCAGAAACCTACCACAGTAAATGTTCCAACTACAGAAGTCTCACCAACTTCTCAGAAAACCACCACAAAAACCACCACACCAAATGCTCAAGCAACACGGAGTACACCTGTTTCCAGGACAACCAAGCATTTTCATGAAACAACCCCAAATAAAGGAAGTGGAACCACTTCAGGTACTACCCGTCTTCTATCTGGGCACACGTGTTTCACGTTGACAGGTTTGCTTGGGACGCTAGTAACCATGGGCTTGCTGACTTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T78114-Ab Anti-DAF/ CD55/ CHAPLE monoclonal antibody
    Target Antigen GM-Tg-g-T78114-Ag CD55 VLP (virus-like particle)
    ORF Viral Vector pGMPC000098 Human CD55 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMAP000525 Human CD55 Adenovirus plasmid
    ORF Viral Vector pGMAP000554 Human CD55 Adenovirus plasmid
    ORF Viral Vector vGMAP000525 Human CD55 Adenovirus particle
    ORF Viral Vector vGMAP000554 Human CD55 Adenovirus particle


    Target information

    Target ID GM-T78114
    Target Name CD55
    Gene ID 1604, 13136, 714370, 64036, 101094644, 609307, 518609, 100057656
    Gene Symbol and Synonyms CD55,CHAPLE,CR,CROM,DAF,Daf-GPI,Daf1,GPI-DAF,TC
    Uniprot Accession P08174
    Uniprot Entry Name DAF_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000196352
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a glycoprotein involved in the regulation of the complement cascade. Binding of the encoded protein to complement proteins accelerates their decay, thereby disrupting the cascade and preventing damage to host cells. Antigens present on this protein constitute the Cromer blood group system (CROM). Alternative splicing results in multiple transcript variants. The predominant transcript variant encodes a membrane-bound protein, but alternatively spliced transcripts may produce soluble proteins. [provided by RefSeq, Jul 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.