Human KRAS/C-K-RAS/ C-K-RAS ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_033360.4)

Pre-made Human KRAS/C-K-RAS/ C-K-RAS Non-Viral expression plasmid (overexpression vector) for mouse KRAS overexpression in unique cell transient transfection and stable cell line development.

Target products collectionGo to KRAS G12C/KRAS/C-K-RAS products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMPC000180 Human KRAS Mammalian (Non-Viral Vector) plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMPC000180
Gene Name KRAS
Accession Number NM_033360.4
Gene ID 3845
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 570 bp
Gene Alias C-K-RAS, C-K-RAS, c-Ki-ras, c-Ki-ras2, CFC2, K-Ras, K-Ras 2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RASK2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGGCAAGAGTGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAACAATAGAGGATTCCTACAGGAAGCAAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTCGACACAGCAGGTCAAGAGGAGTACAGTGCAATGAGGGACCAGTACATGAGGACTGGGGAGGGCTTTCTTTGTGTATTTGCCATAAATAATACTAAATCATTTGAAGATATTCACCATTATAGAGAACAAATTAAAAGAGTTAAGGACTCTGAAGATGTACCTATGGTCCTAGTAGGAAATAAATGTGATTTGCCTTCTAGAACAGTAGACACAAAACAGGCTCAGGACTTAGCAAGAAGTTATGGAATTCCTTTTATTGAAACATCAGCAAAGACAAGACAGAGAGTGGAGGATGCTTTTTATACATTGGTGAGAGAGATCCGACAATACAGATTGAAAAAAATCAGCAAAGAAGAAAAGACTCCTGGCTGTGTGAAAATTAAAAAATGCATTATAATGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T59480-Ab Anti-KRAS G12C monoclonal antibody
    Target Antigen GM-Tg-g-T59480-Ag KRAS G12C/KRAS protein
    ORF Viral Vector pGMPC000180 Human KRAS Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000746 Human KRAS Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP001359 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP001960 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMLP-SPh-051 Human KRAS Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-191 Human KRAS Adenovirus plasmid
    ORF Viral Vector vGMLP001359 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP001960 Human KRAS Lentivirus particle
    ORF Viral Vector vGMLP-SPh-051 Human KRAS Lentivirus particle
    ORF Viral Vector vGMAP-SPh-191 Human KRAS Adenovirus particle


    Target information

    Target ID GM-T59480
    Target Name KRAS G12C
    Gene ID 3845, 16653, 707977, 24525, 751104, 403871, 541140, 100064473
    Gene Symbol and Synonyms 'C-K-RAS,C-K-RAS,c-Ki-ras,c-Ki-ras2,CFC2,K-Ras,K-Ras 2,K-RAS2A,K-RAS2B,K-RAS4A,K-RAS4B,KI-RAS,KRAS,Kras-2,KRAS1,KRAS2,NS,NS3,OES,p21,p21B,p21ras,RALD,ras,RASK2
    Uniprot Accession P01116
    Uniprot Entry Name RASK_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Non-Small Cell Lung Cancer, Colorectal Cancer, Pancreas Cancer
    Gene Ensembl ENSG00000133703
    Target Classification Checkpoint-Immuno Oncology

    This gene, a Kirsten ras oncogene homolog from the mammalian ras gene family, encodes a protein that is a member of the small GTPase superfamily. A single amino acid substitution is responsible for an activating mutation. The transforming protein that results is implicated in various malignancies, including lung adenocarcinoma, mucinous adenoma, ductal carcinoma of the pancreas and colorectal carcinoma. Alternative splicing leads to variants encoding two isoforms that differ in the C-terminal region. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.