Human TPI1/HEL-S-49/TIM ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_001159287.1)

Cat. No.: pGMPC000222
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TPI1/HEL-S-49/TIM Non-Viral expression plasmid (overexpression vector) for mouse TPI1 overexpression in unique cell transient transfection and stable cell line development.


Target products collection

Go to TPI1/HEL-S-49 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC000222
Gene Name TPI1
Accession Number NM_001159287.1
Gene ID 7167
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 861 bp
Gene Alias HEL-S-49,TIM,TPI,TPID
Fluorescent Reporter Null
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGGAGGACGGCGAGGAGGCGGAGTTCCACTTCGCGGCGCTCTATATAAGTGGGCAGTGGCCGCGACTGCGCGCAGACACTGACCTTCAGCGCCTCGGCTCCAGCGCCATGGCGCCCTCCAGGAAGTTCTTCGTTGGGGGAAACTGGAAGATGAACGGGCGGAAGCAGAGTCTGGGGGAGCTCATCGGCACTCTGAACGCGGCCAAGGTGCCGGCCGACACCGAGGTGGTTTGTGCTCCCCCTACTGCCTATATCGACTTCGCCCGGCAGAAGCTAGATCCCAAGATTGCTGTGGCTGCGCAGAACTGCTACAAAGTGACTAATGGGGCTTTTACTGGGGAGATCAGCCCTGGCATGATCAAAGACTGCGGAGCCACGTGGGTGGTCCTGGGGCACTCAGAGAGAAGGCATGTCTTTGGGGAGTCAGATGAGCTGATTGGGCAGAAAGTGGCCCATGCTCTGGCAGAGGGACTCGGAGTAATCGCCTGCATTGGGGAGAAGCTAGATGAAAGGGAAGCTGGCATCACTGAGAAGGTTGTTTTCGAGCAGACAAAGGTCATCGCAGATAACGTGAAGGACTGGAGCAAGGTCGTCCTGGCCTATGAGCCTGTGTGGGCCATTGGTACTGGCAAGACTGCAACACCCCAACAGGCCCAGGAAGTACACGAGAAGCTCCGAGGATGGCTGAAGTCCAACGTCTCTGATGCGGTGGCTCAGAGCACCCGTATCATTTATGGAGGCTCTGTGACTGGGGCAACCTGCAAGGAGCTGGCCAGCCAGCCTGATGTGGATGGCTTCCTTGTGGGTGGTGCTTCCCTCAAGCCCGAATTCGTGGACATCATCAATGCCAAACAATGA
ORF Protein Sequence MAEDGEEAEFHFAALYISGQWPRLRADTDLQRLGSSAMAPSRKFFVGGNWKMNGRKQSLGELIGTLNAAKVPADTEVVCAPPTAYIDFARQKLDPKIAVAAQNCYKVTNGAFTGEISPGMIKDCGATWVVLGHSERRHVFGESDELIGQKVAHALAEGLGVIACIGEKLDEREAGITEKVVFEQTKVIADNVKDWSKVVLAYEPVWAIGTGKTATPQQAQEVHEKLRGWLKSNVSDAVAQSTRIIYGGSVTGATCKELASQPDVDGFLVGGASLKPEFVDIINAKQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2166-Ab Anti-TPI1 monoclonal antibody
    Target Antigen GM-Tg-g-IP2166-Ag TPI1 protein
    ORF Viral Vector pGMLP003331 Human TPI1 Lentivirus plasmid
    ORF Viral Vector pGMLV000924 Human TPI1 Lentivirus plasmid
    ORF Viral Vector pGMPC000222 Human TPI1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP003331 Human TPI1 Lentivirus particle
    ORF Viral Vector vGMLV000924 Human TPI1 Lentivirus particle


    Target information

    Target ID GM-IP2166
    Target Name TPI1
    Gene ID 7167, 21991, 714090, 24849, 101085900, 477711, 281543, 100052671
    Gene Symbol and Synonyms HEL-S-49,TIM,TPI,Tpi-1,TPI1,TPID
    Uniprot Accession P60174
    Uniprot Entry Name TPIS_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Malignant neoplasm of bladder, Congenital occlusion of ureteropelvic junction
    Gene Ensembl ENSG00000111669
    Target Classification Not Available

    This gene encodes an enzyme, consisting of two identical proteins, which catalyzes the isomerization of glyceraldehydes 3-phosphate (G3P) and dihydroxy-acetone phosphate (DHAP) in glycolysis and gluconeogenesis. Mutations in this gene are associated with triosephosphate isomerase deficiency. Pseudogenes have been identified on chromosomes 1, 4, 6 and 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.