Human TPI1/HEL-S-49/TIM ORF/cDNA clone-Lentivirus plasmid (NM_000365)
Cat. No.: pGMLV000924
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human TPI1/HEL-S-49/TIM Lentiviral expression plasmid for TPI1 lentivirus packaging, TPI1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
TPI1/HEL-S-49 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLV000924 |
| Gene Name | TPI1 |
| Accession Number | NM_000365 |
| Gene ID | 7167 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 750 bp |
| Gene Alias | HEL-S-49,TIM,TPI,TPID |
| Fluorescent Reporter | Null |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | Null |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGCGCCCTCCAGGAAGTTCTTCGTTGGGGGAAACTGGAAGATGAACGGGCGGAAGCAGAGTCTGGGGGAGCTCATCGGCACTCTGAACGCGGCCAAGGTGCCGGCCGACACCGAGGTGGTTTGTGCTCCCCCTACTGCCTATATCGACTTCGCCCGGCAGAAGCTAGATCCCAAGATTGCTGTGGCTGCGCAGAACTGCTACAAAGTGACTAATGGGGCTTTTACTGGGGAGATCAGCCCTGGCATGATCAAAGACTGCGGAGCCACGTGGGTGGTCCTGGGGCACTCAGAGAGAAGGCATGTCTTTGGGGAGTCAGATGAGCTGATTGGGCAGAAAGTGGCCCATGCTCTGGCAGAGGGACTCGGAGTAATCGCCTGCATTGGGGAGAAGCTAGATGAAAGGGAAGCTGGCATCACTGAGAAGGTTGTTTTCGAGCAGACAAAGGTCATCGCAGATAACGTGAAGGACTGGAGCAAGGTCGTCCTGGCCTATGAGCCTGTGTGGGCCATTGGTACTGGCAAGACTGCAACACCCCAACAGGCCCAGGAAGTACACGAGAAGCTCCGAGGATGGCTGAAGTCCAACGTCTCTGATGCGGTGGCTCAGAGCACCCGTATCATTTATGGAGGCTCTGTGACTGGGGCAACCTGCAAGGAGCTGGCCAGCCAGCCTGATGTGGATGGCTTCCTTGTGGGTGGTGCTTCCCTCAAGCCCGAATTCGTGGACATCATCAATGCCAAACAATGA |
| ORF Protein Sequence | MAPSRKFFVGGNWKMNGRKQSLGELIGTLNAAKVPADTEVVCAPPTAYIDFARQKLDPKIAVAAQNCYKVTNGAFTGEISPGMIKDCGATWVVLGHSERRHVFGESDELIGQKVAHALAEGLGVIACIGEKLDEREAGITEKVVFEQTKVIADNVKDWSKVVLAYEPVWAIGTGKTATPQQAQEVHEKLRGWLKSNVSDAVAQSTRIIYGGSVTGATCKELASQPDVDGFLVGGASLKPEFVDIINAKQ |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-IP2166-Ab | Anti-TPI1 monoclonal antibody |
| Target Antigen | GM-Tg-g-IP2166-Ag | TPI1 protein |
| ORF Viral Vector | pGMLP003331 | Human TPI1 Lentivirus plasmid |
| ORF Viral Vector | pGMLV000924 | Human TPI1 Lentivirus plasmid |
| ORF Viral Vector | pGMPC000222 | Human TPI1 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLP003331 | Human TPI1 Lentivirus particle |
| ORF Viral Vector | vGMLV000924 | Human TPI1 Lentivirus particle |
Target information
| Target ID | GM-IP2166 |
| Target Name | TPI1 |
| Gene ID | 7167, 21991, 714090, 24849, 101085900, 477711, 281543, 100052671 |
| Gene Symbol and Synonyms | HEL-S-49,TIM,TPI,Tpi-1,TPI1,TPID |
| Uniprot Accession | P60174 |
| Uniprot Entry Name | TPIS_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Not Available |
| Disease | Malignant neoplasm of bladder, Congenital occlusion of ureteropelvic junction |
| Gene Ensembl | ENSG00000111669 |
| Target Classification | Not Available |
This gene encodes an enzyme, consisting of two identical proteins, which catalyzes the isomerization of glyceraldehydes 3-phosphate (G3P) and dihydroxy-acetone phosphate (DHAP) in glycolysis and gluconeogenesis. Mutations in this gene are associated with triosephosphate isomerase deficiency. Pseudogenes have been identified on chromosomes 1, 4, 6 and 7. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


