Human AGTR1/AG2S/ AGTR1B ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_004835.4)
Pre-made Human AGTR1/AG2S/ AGTR1B Non-Viral expression plasmid (overexpression vector) for mouse AGTR1 overexpression in unique cell transient transfection and stable cell line development.
Go
to AGTR1/AG2S products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMPC000236 | Human AGTR1 Mammalian (Non-Viral Vector) plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMPC000236 |
Gene Name | AGTR1 |
Accession Number | NM_004835.4 |
Gene ID | 185 |
Species | Human |
Product Type | Mammalian (Non-Viral Vector) plasmid (overexpression) |
Insert Length | 1185 bp |
Gene Alias | AG2S, AGTR1B, AT1, AT1AR, AT1B, AT1BR, AT1R, AT2R1, HAT1R |
Fluorescent Reporter | YFP(YCE) |
Mammalian Cell Selection | |
Fusion Tag | HA(C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAAGAAAATGAATCACAAGTCAACTGACAGTCCAAAGGCTCCACAGCTCAGAGGAGGTGTATTTGATATAGTGTTTGCAACAAATTCGACCCAGGTGATCAAAATGATTCTCAACTCTTCTACTGAAGATGGTATTAAAAGAATCCAAGATGATTGTCCCAAAGCTGGAAGGCATAATTACATATTTGTCATGATTCCTACTTTATACAGTATCATCTTTGTGGTGGGAATATTTGGAAACAGCTTGGTGGTGATAGTCATTTACTTTTATATGAAGCTGAAGACTGTGGCCAGTGTTTTTCTTTTGAATTTAGCACTGGCTGACTTATGCTTTTTACTGACTTTGCCACTATGGGCTGTCTACACAGCTATGGAATACCGCTGGCCCTTTGGCAATTACCTATGTAAGATTGCTTCAGCCAGCGTCAGTTTCAACCTGTACGCTAGTGTGTTTCTACTCACGTGTCTCAGCATTGATCGATACCTGGCTATTGTTCACCCAATGAAGTCCCGCCTTCGACGCACAATGCTTGTAGCCAAAGTCACCTGCATCATCATTTGGCTGCTGGCAGGCTTGGCCAGTTTGCCAGCTATAATCCATCGAAATGTATTTTTCATTGAGAACACCAATATTACAGTTTGTGCTTTCCATTATGAGTCCCAAAATTCAACCCTCCCGATAGGGCTGGGCCTGACCAAAAATATACTGGGTTTCCTGTTTCCTTTTCTGATCATTCTTACAAGTTATACTCTTATTTGGAAGGCCCTAAAGAAGGCTTATGAAATTCAGAAGAACAAACCAAGAAATGATGATATTTTTAAGATAATTATGGCAATTGTGCTTTTCTTTTTCTTTTCCTGGATTCCCCACCAAATATTCACTTTTCTGGATGTATTGATTCAACTAGGCATCATACGTGACTGTAGAATTGCAGATATTGTGGACACGGCCATGCCTATCACCATTTGTATAGCTTATTTTAACAATTGCCTGAATCCTCTTTTTTATGGCTTTCTGGGGAAAAAATTTAAAAGATATTTTCTCCAGCTTCTAAAATATATTCCCCCAAAAGCCAAATCCCACTCAAACCTTTCAACAAAAATGAGCACGCTTTCCTACCGCCCCTCAGATAATGTAAGCTCATCCACCAAGAAGCCTGCACCATGTTTTGAGGTTGAGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T74456-Ab | Anti-AGTR1/ AG2SB/ AT1 monoclonal antibody |
Target Antigen | GM-Tg-g-T74456-Ag | AGTR1 VLP (virus-like particle) |
ORF Viral Vector | pGMLV000160 | Human AGTR1 Lentivirus plasmid |
ORF Viral Vector | pGMAD000019 | Human AGTR1 Adenovirus plasmid |
ORF Viral Vector | pGMPC000236 | Human AGTR1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLV000160 | Human AGTR1 Lentivirus particle |
ORF Viral Vector | vGMAD000019 | Human AGTR1 Adenovirus particle |
Target information
Target ID | GM-T74456 |
Target Name | AGTR1 |
Gene ID | 185, 11608, 712773, 81638, 101082936, 403836, 281607, 100059005 |
Gene Symbol and Synonyms | AG2S,Agtr-1b,AGTR1,AGTR1B,Angtr-1b,AT1,AT1AR,AT1B,AT1BR,AT1R,AT2R1,AT2R1B,AT3,AT1R,ATR1,HAT1R |
Uniprot Accession | P30556 |
Uniprot Entry Name | AGTR1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000144891 |
Target Classification | GPCR |
Angiotensin II is a potent vasopressor hormone and a primary regulator of aldosterone secretion. It is an important effector controlling blood pressure and volume in the cardiovascular system. It acts through at least two types of receptors. This gene encodes the type 1 receptor which is thought to mediate the major cardiovascular effects of angiotensin II. This gene may play a role in the generation of reperfusion arrhythmias following restoration of blood flow to ischemic or infarcted myocardium. It was previously thought that a related gene, denoted as AGTR1B, existed; however, it is now believed that there is only one type 1 receptor gene in humans. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.