Human AGTR1/AG2S/ AGTR1B ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_004835.4)

Pre-made Human AGTR1/AG2S/ AGTR1B Non-Viral expression plasmid (overexpression vector) for mouse AGTR1 overexpression in unique cell transient transfection and stable cell line development.

Target products collectionGo to AGTR1/AG2S products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMPC000236 Human AGTR1 Mammalian (Non-Viral Vector) plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMPC000236
Gene Name AGTR1
Accession Number NM_004835.4
Gene ID 185
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 1185 bp
Gene Alias AG2S, AGTR1B, AT1, AT1AR, AT1B, AT1BR, AT1R, AT2R1, HAT1R
Fluorescent Reporter YFP(YCE)
Mammalian Cell Selection
Fusion Tag HA(C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAGAAAATGAATCACAAGTCAACTGACAGTCCAAAGGCTCCACAGCTCAGAGGAGGTGTATTTGATATAGTGTTTGCAACAAATTCGACCCAGGTGATCAAAATGATTCTCAACTCTTCTACTGAAGATGGTATTAAAAGAATCCAAGATGATTGTCCCAAAGCTGGAAGGCATAATTACATATTTGTCATGATTCCTACTTTATACAGTATCATCTTTGTGGTGGGAATATTTGGAAACAGCTTGGTGGTGATAGTCATTTACTTTTATATGAAGCTGAAGACTGTGGCCAGTGTTTTTCTTTTGAATTTAGCACTGGCTGACTTATGCTTTTTACTGACTTTGCCACTATGGGCTGTCTACACAGCTATGGAATACCGCTGGCCCTTTGGCAATTACCTATGTAAGATTGCTTCAGCCAGCGTCAGTTTCAACCTGTACGCTAGTGTGTTTCTACTCACGTGTCTCAGCATTGATCGATACCTGGCTATTGTTCACCCAATGAAGTCCCGCCTTCGACGCACAATGCTTGTAGCCAAAGTCACCTGCATCATCATTTGGCTGCTGGCAGGCTTGGCCAGTTTGCCAGCTATAATCCATCGAAATGTATTTTTCATTGAGAACACCAATATTACAGTTTGTGCTTTCCATTATGAGTCCCAAAATTCAACCCTCCCGATAGGGCTGGGCCTGACCAAAAATATACTGGGTTTCCTGTTTCCTTTTCTGATCATTCTTACAAGTTATACTCTTATTTGGAAGGCCCTAAAGAAGGCTTATGAAATTCAGAAGAACAAACCAAGAAATGATGATATTTTTAAGATAATTATGGCAATTGTGCTTTTCTTTTTCTTTTCCTGGATTCCCCACCAAATATTCACTTTTCTGGATGTATTGATTCAACTAGGCATCATACGTGACTGTAGAATTGCAGATATTGTGGACACGGCCATGCCTATCACCATTTGTATAGCTTATTTTAACAATTGCCTGAATCCTCTTTTTTATGGCTTTCTGGGGAAAAAATTTAAAAGATATTTTCTCCAGCTTCTAAAATATATTCCCCCAAAAGCCAAATCCCACTCAAACCTTTCAACAAAAATGAGCACGCTTTCCTACCGCCCCTCAGATAATGTAAGCTCATCCACCAAGAAGCCTGCACCATGTTTTGAGGTTGAGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T74456-Ab Anti-AGTR1/ AG2SB/ AT1 monoclonal antibody
    Target Antigen GM-Tg-g-T74456-Ag AGTR1 VLP (virus-like particle)
    ORF Viral Vector pGMLV000160 Human AGTR1 Lentivirus plasmid
    ORF Viral Vector pGMAD000019 Human AGTR1 Adenovirus plasmid
    ORF Viral Vector pGMPC000236 Human AGTR1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000160 Human AGTR1 Lentivirus particle
    ORF Viral Vector vGMAD000019 Human AGTR1 Adenovirus particle


    Target information

    Target ID GM-T74456
    Target Name AGTR1
    Gene ID 185, 11608, 712773, 81638, 101082936, 403836, 281607, 100059005
    Gene Symbol and Synonyms AG2S,Agtr-1b,AGTR1,AGTR1B,Angtr-1b,AT1,AT1AR,AT1B,AT1BR,AT1R,AT2R1,AT2R1B,AT3,AT1R,ATR1,HAT1R
    Uniprot Accession P30556
    Uniprot Entry Name AGTR1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000144891
    Target Classification GPCR

    Angiotensin II is a potent vasopressor hormone and a primary regulator of aldosterone secretion. It is an important effector controlling blood pressure and volume in the cardiovascular system. It acts through at least two types of receptors. This gene encodes the type 1 receptor which is thought to mediate the major cardiovascular effects of angiotensin II. This gene may play a role in the generation of reperfusion arrhythmias following restoration of blood flow to ischemic or infarcted myocardium. It was previously thought that a related gene, denoted as AGTR1B, existed; however, it is now believed that there is only one type 1 receptor gene in humans. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.