Human IDO1/IDO/ IDO-1 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_002164.5)
Pre-made Human IDO1/IDO/ IDO-1 Non-Viral expression plasmid (overexpression vector) for mouse IDO1 overexpression in unique cell transient transfection and stable cell line development.
Go
to IDO1/IDO products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMPC000324 | Human IDO1 Mammalian (Non-Viral Vector) plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMPC000324 |
Gene Name | IDO1 |
Accession Number | NM_002164.5 |
Gene ID | 3620 |
Species | Human |
Product Type | Mammalian (Non-Viral Vector) plasmid (overexpression) |
Insert Length | 1212 bp |
Gene Alias | IDO, IDO-1, INDO |
Fluorescent Reporter | EGFP |
Mammalian Cell Selection | |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCACACGCTATGGAAAACTCCTGGACAATCAGTAAAGAGTACCATATTGATGAAGAAGTGGGCTTTGCTCTGCCAAATCCACAGGAAAATCTACCTGATTTTTATAATGACTGGATGTTCATTGCTAAACATCTGCCTGATCTCATAGAGTCTGGCCAGCTTCGAGAAAGAGTTGAGAAGTTAAACATGCTCAGCATTGATCATCTCACAGACCACAAGTCACAGCGCCTTGCACGTCTAGTTCTGGGATGCATCACCATGGCATATGTGTGGGGCAAAGGTCATGGAGATGTCCGTAAGGTCTTGCCAAGAAATATTGCTGTTCCTTACTGCCAACTCTCCAAGAAACTGGAACTGCCTCCTATTTTGGTTTATGCAGACTGTGTCTTGGCAAACTGGAAGAAAAAGGATCCTAATAAGCCCCTGACTTATGAGAACATGGACGTTTTGTTCTCATTTCGTGATGGAGACTGCAGTAAAGGATTCTTCCTGGTCTCTCTATTGGTGGAAATAGCAGCTGCTTCTGCAATCAAAGTAATTCCTACTGTATTCAAGGCAATGCAAATGCAAGAACGGGACACTTTGCTAAAGGCGCTGTTGGAAATAGCTTCTTGCTTGGAGAAAGCCCTTCAAGTGTTTCACCAAATCCACGATCATGTGAACCCAAAAGCATTTTTCAGTGTTCTTCGCATATATTTGTCTGGCTGGAAAGGCAACCCCCAGCTATCAGACGGTCTGGTGTATGAAGGGTTCTGGGAAGACCCAAAGGAGTTTGCAGGGGGCAGTGCAGGCCAAAGCAGCGTCTTTCAGTGCTTTGACGTCCTGCTGGGCATCCAGCAGACTGCTGGTGGAGGACATGCTGCTCAGTTCCTCCAGGACATGAGAAGATATATGCCACCAGCTCACAGGAACTTCCTGTGCTCATTAGAGTCAAATCCCTCAGTCCGTGAGTTTGTCCTTTCAAAAGGTGATGCTGGCCTGCGGGAAGCTTATGACGCCTGTGTGAAAGCTCTGGTCTCCCTGAGGAGCTACCATCTGCAAATCGTGACTAAGTACATCCTGATTCCTGCAAGCCAGCAGCCAAAGGAGAATAAGACCTCTGAAGACCCTTCAAAACTGGAAGCCAAAGGAACTGGAGGCACTGATTTAATGAATTTCCTGAAGACTGTAAGAAGTACAACTGAGAAATCCCTTTTGAAGGAAGGTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T89697-Ab | Anti-IDO1 monoclonal antibody |
Target Antigen | GM-Tg-g-T89697-Ag | IDO1 protein |
ORF Viral Vector | pGMLV000300 | Human IDO1 Lentivirus plasmid |
ORF Viral Vector | pGMAD000139 | Human IDO1 Adenovirus plasmid |
ORF Viral Vector | pGMPC000324 | Human IDO1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLV000300 | Human IDO1 Lentivirus particle |
ORF Viral Vector | vGMAD000139 | Human IDO1 Adenovirus particle |
ORF Viral Vector | pGMLV002494 | Human IDO1 Lentivirus plasmid |
Target information
Target ID | GM-T89697 |
Target Name | IDO1 |
Gene ID | 3620, 15930, 574370, 66029, 101096977, 475574, 506281, 106782641 |
Gene Symbol and Synonyms | IDO,IDO-1,IDO1,INDO |
Uniprot Accession | P14902 |
Uniprot Entry Name | I23O1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target, Immuno-oncology Target |
Disease | Cancer |
Gene Ensembl | ENSG00000131203 |
Target Classification | Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA) |
This gene encodes indoleamine 2,3-dioxygenase (IDO) - a heme enzyme that catalyzes the first and rate-limiting step in tryptophan catabolism to N-formyl-kynurenine. This enzyme acts on multiple tryptophan substrates including D-tryptophan, L-tryptophan, 5-hydroxy-tryptophan, tryptamine, and serotonin. This enzyme is thought to play a role in a variety of pathophysiological processes such as antimicrobial and antitumor defense, neuropathology, immunoregulation, and antioxidant activity. Through its expression in dendritic cells, monocytes, and macrophages this enzyme modulates T-cell behavior by its peri-cellular catabolization of the essential amino acid tryptophan.[provided by RefSeq, Feb 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.