Human IDO1/IDO/ IDO-1 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_002164.5)

Pre-made Human IDO1/IDO/ IDO-1 Non-Viral expression plasmid (overexpression vector) for mouse IDO1 overexpression in unique cell transient transfection and stable cell line development.

Target products collectionGo to IDO1/IDO products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMPC000324 Human IDO1 Mammalian (Non-Viral Vector) plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMPC000324
Gene Name IDO1
Accession Number NM_002164.5
Gene ID 3620
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 1212 bp
Gene Alias IDO, IDO-1, INDO
Fluorescent Reporter EGFP
Mammalian Cell Selection
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCACACGCTATGGAAAACTCCTGGACAATCAGTAAAGAGTACCATATTGATGAAGAAGTGGGCTTTGCTCTGCCAAATCCACAGGAAAATCTACCTGATTTTTATAATGACTGGATGTTCATTGCTAAACATCTGCCTGATCTCATAGAGTCTGGCCAGCTTCGAGAAAGAGTTGAGAAGTTAAACATGCTCAGCATTGATCATCTCACAGACCACAAGTCACAGCGCCTTGCACGTCTAGTTCTGGGATGCATCACCATGGCATATGTGTGGGGCAAAGGTCATGGAGATGTCCGTAAGGTCTTGCCAAGAAATATTGCTGTTCCTTACTGCCAACTCTCCAAGAAACTGGAACTGCCTCCTATTTTGGTTTATGCAGACTGTGTCTTGGCAAACTGGAAGAAAAAGGATCCTAATAAGCCCCTGACTTATGAGAACATGGACGTTTTGTTCTCATTTCGTGATGGAGACTGCAGTAAAGGATTCTTCCTGGTCTCTCTATTGGTGGAAATAGCAGCTGCTTCTGCAATCAAAGTAATTCCTACTGTATTCAAGGCAATGCAAATGCAAGAACGGGACACTTTGCTAAAGGCGCTGTTGGAAATAGCTTCTTGCTTGGAGAAAGCCCTTCAAGTGTTTCACCAAATCCACGATCATGTGAACCCAAAAGCATTTTTCAGTGTTCTTCGCATATATTTGTCTGGCTGGAAAGGCAACCCCCAGCTATCAGACGGTCTGGTGTATGAAGGGTTCTGGGAAGACCCAAAGGAGTTTGCAGGGGGCAGTGCAGGCCAAAGCAGCGTCTTTCAGTGCTTTGACGTCCTGCTGGGCATCCAGCAGACTGCTGGTGGAGGACATGCTGCTCAGTTCCTCCAGGACATGAGAAGATATATGCCACCAGCTCACAGGAACTTCCTGTGCTCATTAGAGTCAAATCCCTCAGTCCGTGAGTTTGTCCTTTCAAAAGGTGATGCTGGCCTGCGGGAAGCTTATGACGCCTGTGTGAAAGCTCTGGTCTCCCTGAGGAGCTACCATCTGCAAATCGTGACTAAGTACATCCTGATTCCTGCAAGCCAGCAGCCAAAGGAGAATAAGACCTCTGAAGACCCTTCAAAACTGGAAGCCAAAGGAACTGGAGGCACTGATTTAATGAATTTCCTGAAGACTGTAAGAAGTACAACTGAGAAATCCCTTTTGAAGGAAGGTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T89697-Ab Anti-IDO1 monoclonal antibody
    Target Antigen GM-Tg-g-T89697-Ag IDO1 protein
    ORF Viral Vector pGMLV000300 Human IDO1 Lentivirus plasmid
    ORF Viral Vector pGMAD000139 Human IDO1 Adenovirus plasmid
    ORF Viral Vector pGMPC000324 Human IDO1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000300 Human IDO1 Lentivirus particle
    ORF Viral Vector vGMAD000139 Human IDO1 Adenovirus particle
    ORF Viral Vector pGMLV002494 Human IDO1 Lentivirus plasmid


    Target information

    Target ID GM-T89697
    Target Name IDO1
    Gene ID 3620, 15930, 574370, 66029, 101096977, 475574, 506281, 106782641
    Gene Symbol and Synonyms IDO,IDO-1,IDO1,INDO
    Uniprot Accession P14902
    Uniprot Entry Name I23O1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Cancer
    Gene Ensembl ENSG00000131203
    Target Classification Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA)

    This gene encodes indoleamine 2,3-dioxygenase (IDO) - a heme enzyme that catalyzes the first and rate-limiting step in tryptophan catabolism to N-formyl-kynurenine. This enzyme acts on multiple tryptophan substrates including D-tryptophan, L-tryptophan, 5-hydroxy-tryptophan, tryptamine, and serotonin. This enzyme is thought to play a role in a variety of pathophysiological processes such as antimicrobial and antitumor defense, neuropathology, immunoregulation, and antioxidant activity. Through its expression in dendritic cells, monocytes, and macrophages this enzyme modulates T-cell behavior by its peri-cellular catabolization of the essential amino acid tryptophan.[provided by RefSeq, Feb 2011]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.