Human E2F1/E2F-1/ RBAP1 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_005225.3)

Pre-made Human E2F1/E2F-1/ RBAP1 Non-Viral expression plasmid (overexpression vector) for mouse E2F1 overexpression in unique cell transient transfection and stable cell line development.

Target products collectionGo to E2F1/E2F-1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMPC000581 Human E2F1 Mammalian (Non-Viral Vector) plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMPC000581
Gene Name E2F1
Accession Number NM_005225.3
Gene ID 1869
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 1314 bp
Gene Alias E2F-1, RBAP1, RBBP3, RBP3
Fluorescent Reporter
Mammalian Cell Selection Null
Fusion Tag Null
Promoter CMV
Resistance Amplicin
Sequence ATGGCCTTGGCCGGGGCCCCTGCGGGCGGCCCATGCGCGCCGGCGCTGGAGGCCCTGCTCGGGGCCGGCGCGCTGCGGCTGCTCGACTCCTCGCAGATCGTCATCATCTCCGCCGCGCAGGACGCCAGCGCCCCGCCGGCTCCCACCGGCCCCGCGGCGCCCGCCGCCGGCCCCTGCGACCCTGACCTGCTGCTCTTCGCCACACCGCAGGCGCCCCGGCCCACACCCAGTGCGCCGCGGCCCGCGCTCGGCCGCCCGCCGGTGAAGCGGAGGCTGGACCTGGAAACTGACCATCAGTACCTGGCCGAGAGCAGTGGGCCAGCTCGGGGCAGAGGCCGCCATCCAGGAAAAGGTGTGAAATCCCCGGGGGAGAAGTCACGCTATGAGACCTCACTGAATCTGACCACCAAGCGCTTCCTGGAGCTGCTGAGCCACTCGGCTGACGGTGTCGTCGACCTGAACTGGGCTGCCGAGGTGCTGAAGGTGCAGAAGCGGCGCATCTATGACATCACCAACGTCCTTGAGGGCATCCAGCTCATTGCCAAGAAGTCCAAGAACCACATCCAGTGGCTGGGCAGCCACACCACAGTGGGCGTCGGCGGACGGCTTGAGGGGTTGACCCAGGACCTCCGACAGCTGCAGGAGAGCGAGCAGCAGCTGGACCACCTGATGAATATCTGTACTACGCAGCTGCGCCTGCTCTCCGAGGACACTGACAGCCAGCGCCTGGCCTACGTGACGTGTCAGGACCTTCGTAGCATTGCAGACCCTGCAGAGCAGATGGTTATGGTGATCAAAGCCCCTCCTGAGACCCAGCTCCAAGCCGTGGACTCTTCGGAGAACTTTCAGATCTCCCTTAAGAGCAAACAAGGCCCGATCGATGTTTTCCTGTGCCCTGAGGAGACCGTAGGTGGGATCAGCCCTGGGAAGACCCCATCCCAGGAGGTCACTTCTGAGGAGGAGAACAGGGCCACTGACTCTGCCACCATAGTGTCACCACCACCATCATCTCCCCCCTCATCCCTCACCACAGATCCCAGCCAGTCTCTACTCAGCCTGGAGCAAGAACCGCTGTTGTCCCGGATGGGCAGCCTGCGGGCTCCCGTGGACGAGGACCGCCTGTCCCCGCTGGTGGCGGCCGACTCGCTCCTGGAGCATGTGCGGGAGGACTTCTCCGGCCTCCTCCCTGAGGAGTTCATCAGCCTTTCCCCACCCCACGAGGCCCTCGACTACCACTTCGGCCTCGAGGAGGGCGAGGGCATCAGAGACCTCTTCGACTGTGACTTTGGGGACCTCACCCCCCTGGATTTCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T57059-Ab Anti-E2F1 monoclonal antibody
    Target Antigen GM-Tg-g-T57059-Ag E2F1 protein
    ORF Viral Vector pGMLV000914 Human E2F1 Lentivirus plasmid
    ORF Viral Vector pGMAD000181 Human E2F1 Adenovirus plasmid
    ORF Viral Vector pGMPC000581 Human E2F1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000914 Human E2F1 Lentivirus particle
    ORF Viral Vector vGMAD000181 Human E2F1 Adenovirus particle


    Target information

    Target ID GM-T57059
    Target Name E2F1
    Gene ID 1869, 13555, 714126, 399489, 101098454, 485839, 535369, 100069192
    Gene Symbol and Synonyms E2F-1,E2F1,mKIAA4009,RBAP1,RBBP3,RBP3,Tg(Wnt1-cre)2Sor
    Uniprot Accession Q01094
    Uniprot Entry Name E2F1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000101412
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain.  This protein and another 2 members, E2F2 and E2F3, have an additional cyclin binding domain. This protein binds preferentially to retinoblastoma protein pRB in a cell-cycle dependent manner. It can mediate both cell proliferation and p53-dependent/independent apoptosis. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.