Human E2F1/E2F-1/ RBAP1 ORF/cDNA clone-Lentivirus particle (NM_005225.2)
Pre-made Human E2F1/E2F-1/ RBAP1 Lentiviral expression plasmid for E2F1 lentivirus packaging, E2F1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to E2F1/E2F-1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLV000914 | Human E2F1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLV000914 |
Gene Name | E2F1 |
Accession Number | NM_005225.2 |
Gene ID | 1869 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1314 bp |
Gene Alias | E2F-1, RBAP1, RBBP3, RBP3 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocinmyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCCTTGGCCGGGGCCCCTGCGGGCGGCCCATGCGCGCCGGCGCTGGAGGCCCTGCTCGGGGCCGGCGCGCTGCGGCTGCTCGACTCCTCGCAGATCGTCATCATCTCCGCCGCGCAGGACGCCAGCGCCCCGCCGGCTCCCACCGGCCCCGCGGCGCCCGCCGCCGGCCCCTGCGACCCTGACCTGCTGCTCTTCGCCACACCGCAGGCGCCCCGGCCCACACCCAGTGCGCCGCGGCCCGCGCTCGGCCGCCCGCCGGTGAAGCGGAGGCTGGACCTGGAAACTGACCATCAGTACCTGGCCGAGAGCAGTGGGCCAGCTCGGGGCAGAGGCCGCCATCCAGGAAAAGGTGTGAAATCCCCGGGGGAGAAGTCACGCTATGAGACCTCACTGAATCTGACCACCAAGCGCTTCCTGGAGCTGCTGAGCCACTCGGCTGACGGTGTCGTCGACCTGAACTGGGCTGCCGAGGTGCTGAAGGTGCAGAAGCGGCGCATCTATGACATCACCAACGTCCTTGAGGGCATCCAGCTCATTGCCAAGAAGTCCAAGAACCACATCCAGTGGCTGGGCAGCCACACCACAGTGGGCGTCGGCGGACGGCTTGAGGGGTTGACCCAGGACCTCCGACAGCTGCAGGAGAGCGAGCAGCAGCTGGACCACCTGATGAATATCTGTACTACGCAGCTGCGCCTGCTCTCCGAGGACACTGACAGCCAGCGCCTGGCCTACGTGACGTGTCAGGACCTTCGTAGCATTGCAGACCCTGCAGAGCAGATGGTTATGGTGATCAAAGCCCCTCCTGAGACCCAGCTCCAAGCCGTGGACTCTTCGGAGAACTTTCAGATCTCCCTTAAGAGCAAACAAGGCCCGATCGATGTTTTCCTGTGCCCTGAGGAGACCGTAGGTGGGATCAGCCCTGGGAAGACCCCATCCCAGGAGGTCACTTCTGAGGAGGAGAACAGGGCCACTGACTCTGCCACCATAGTGTCACCACCACCATCATCTCCCCCCTCATCCCTCACCACAGATCCCAGCCAGTCTCTACTCAGCCTGGAGCAAGAACCGCTGTTGTCCCGGATGGGCAGCCTGCGGGCTCCCGTGGACGAGGACCGCCTGTCCCCGCTGGTGGCGGCCGACTCGCTCCTGGAGCATGTGCGGGAGGACTTCTCCGGCCTCCTCCCTGAGGAGTTCATCAGCCTTTCCCCACCCCACGAGGCCCTCGACTACCACTTCGGCCTCGAGGAGGGCGAGGGCATCAGAGACCTCTTCGACTGTGACTTTGGGGACCTCACCCCCCTGGATTTCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T57059-Ab | Anti-E2F1 monoclonal antibody |
Target Antigen | GM-Tg-g-T57059-Ag | E2F1 protein |
ORF Viral Vector | pGMLV000914 | Human E2F1 Lentivirus plasmid |
ORF Viral Vector | pGMAD000181 | Human E2F1 Adenovirus plasmid |
ORF Viral Vector | pGMPC000581 | Human E2F1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLV000914 | Human E2F1 Lentivirus particle |
ORF Viral Vector | vGMAD000181 | Human E2F1 Adenovirus particle |
Target information
Target ID | GM-T57059 |
Target Name | E2F1 |
Gene ID | 1869, 13555, 714126, 399489, 101098454, 485839, 535369, 100069192 |
Gene Symbol and Synonyms | E2F-1,E2F1,mKIAA4009,RBAP1,RBBP3,RBP3,Tg(Wnt1-cre)2Sor |
Uniprot Accession | Q01094 |
Uniprot Entry Name | E2F1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000101412 |
Target Classification | Tumor-associated antigen (TAA) |
The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein and another 2 members, E2F2 and E2F3, have an additional cyclin binding domain. This protein binds preferentially to retinoblastoma protein pRB in a cell-cycle dependent manner. It can mediate both cell proliferation and p53-dependent/independent apoptosis. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.