Human MMP7/MMP-7/ MPSL1 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_002423.5)

Product information

Catalog No.	Product Name	Plasmid Grade	Plasmid quantity
pGMPC000761	Human MMP7 Mammalian (Non-Viral Vector) plasmid	Research Grade	10mg, 50mg, 100mg, 500mg, >1g
		GMP-like Grade	10mg, 50mg, 100mg, 500mg, >1g
		High Quality (HQ) Grade
		Seed	5ug

Product Description

Catalog ID	pGMPC000761
Gene Name	MMP7
Accession Number	NM_002423.5
Gene ID	4316
Species	Human
Product Type	Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length	804 bp
Gene Alias	MMP-7, MPSL1, PUMP-1
Fluorescent Reporter	EGFP
Mammalian Cell Selection
Fusion Tag	3xflag (C-Terminal)
Promoter	CMV
Resistance	Amplicin
Sequence	ATGCGACTCACCGTGCTGTGTGCTGTGTGCCTGCTGCCTGGCAGCCTGGCCCTGCCGCTGCCTCAGGAGGCGGGAGGCATGAGTGAGCTACAGTGGGAACAGGCTCAGGACTATCTCAAGAGATTTTATCTCTATGACTCAGAAACAAAAAATGCCAACAGTTTAGAAGCCAAACTCAAGGAGATGCAAAAATTCTTTGGCCTACCTATAACTGGAATGTTAAACTCCCGCGTCATAGAAATAATGCAGAAGCCCAGATGTGGAGTGCCAGATGTTGCAGAATACTCACTATTTCCAAATAGCCCAAAATGGACTTCCAAAGTGGTCACCTACAGGATCGTATCATATACTCGAGACTTACCGCATATTACAGTGGATCGATTAGTGTCAAAGGCTTTAAACATGTGGGGCAAAGAGATCCCCCTGCATTTCAGGAAAGTTGTATGGGGAACTGCTGACATCATGATTGGCTTTGCGCGAGGAGCTCATGGGGACTCCTACCCATTTGATGGGCCAGGAAACACGCTGGCTCATGCCTTTGCGCCTGGGACAGGTCTCGGAGGAGATGCTCACTTCGATGAGGATGAACGCTGGACGGATGGTAGCAGTCTAGGGATTAACTTCCTGTATGCTGCAACTCATGAACTTGGCCATTCTTTGGGTATGGGACATTCCTCTGATCCTAATGCAGTGATGTATCCAACCTATGGAAATGGAGATCCCCAAAATTTTAAACTTTCCCAGGATGATATTAAAGGCATTCAGAAACTATATGGAAAGAGAAGTAATTCAAGAAAGAAATAG

Reference

Data / case study

Click to get more Data / Case study about the product.

Associated products

Category	Cat No.	Products Name
Target Antibody	GM-Tg-g-T73475-Ab	Anti-MMP7/ MMP-7/ MPSL1 functional antibody
Target Antigen	GM-Tg-g-T73475-Ag	MMP-7/MMP7 protein
ORF Viral Vector	pGMPC000761	Human MMP7 Mammalian (Non-Viral Vector) plasmid
ORF Viral Vector	pGMLP003953	Human MMP7 Lentivirus plasmid
ORF Viral Vector	vGMLP003953	Human MMP7 Lentivirus particle
ORF Viral Vector	pGMLV002265	Human MMP7 Lentivirus plasmid

Target information

Target ID	GM-T73475
Target Name	MMP-7
Gene ID	4316, 17393, 703072, 25335, 727698, 489432, 286794, 100068985
Gene Symbol and Synonyms	MAT,Matrilysin,MMP-7,MMP7,MPMM,MPSL1,PUMP-1
Uniprot Accession	P09237
Uniprot Entry Name	MMP7_HUMAN
Protein Sub-location	Secreted Protein/Potential Cytokines
Category	Therapeutics Target
Disease	Ovary Cancer, Chronic Kidney Disease
Gene Ensembl	ENSG00000137673
Target Classification	Not Available

This gene encodes a member of the peptidase M10 family of matrix metalloproteinases (MMPs). Proteins in this family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. The encoded preproprotein is proteolytically processed to generate the mature protease. This secreted protease breaks down proteoglycans, fibronectin, elastin and casein and differs from most MMP family members in that it lacks a conserved C-terminal hemopexin domain. The enzyme is involved in wound healing, and studies in mice suggest that it regulates the activity of defensins in intestinal mucosa. The gene is part of a cluster of MMP genes on chromosome 11. This gene exhibits elevated expression levels in multiple human cancers. [provided by RefSeq, Jan 2016]

About GMVC