Human MMP7/MMP-7/ MPSL1 ORF/cDNA clone-Lentivirus particle (NM_002423)
Pre-made Human MMP7/MMP-7/ MPSL1 Lentiviral expression plasmid for MMP7 lentivirus packaging, MMP7 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to MMP-7/MMP7 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP003953 | Human MMP7 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP003953 |
Gene Name | MMP7 |
Accession Number | NM_002423 |
Gene ID | 4316 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 804 bp |
Gene Alias | MMP-7, MPSL1, PUMP-1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCGACTCACCGTGCTGTGTGCTGTGTGCCTGCTGCCTGGCAGCCTGGCCCTGCCGCTGCCTCAGGAGGCGGGAGGCATGAGTGAGCTACAGTGGGAACAGGCTCAGGACTATCTCAAGAGATTTTATCTCTATGACTCAGAAACAAAAAATGCCAACAGTTTAGAAGCCAAACTCAAGGAGATGCAAAAATTCTTTGGCCTACCTATAACTGGAATGTTAAACTCCCGCGTCATAGAAATAATGCAGAAGCCCAGATGTGGAGTGCCAGATGTTGCAGAATACTCACTATTTCCAAATAGCCCAAAATGGACTTCCAAAGTGGTCACCTACAGGATCGTATCATATACTCGAGACTTACCGCATATTACAGTGGATCGATTAGTGTCAAAGGCTTTAAACATGTGGGGCAAAGAGATCCCCCTGCATTTCAGGAAAGTTGTATGGGGAACTGCTGACATCATGATTGGCTTTGCGCGAGGAGCTCATGGGGACTCCTACCCATTTGATGGGCCAGGAAACACGCTGGCTCATGCCTTTGCGCCTGGGACAGGTCTCGGAGGAGATGCTCACTTCGATGAGGATGAACGCTGGACGGATGGTAGCAGTCTAGGGATTAACTTCCTGTATGCTGCAACTCATGAACTTGGCCATTCTTTGGGTATGGGACATTCCTCTGATCCTAATGCAGTGATGTATCCAACCTATGGAAATGGAGATCCCCAAAATTTTAAACTTTCCCAGGATGATATTAAAGGCATTCAGAAACTATATGGAAAGAGAAGTAATTCAAGAAAGAAATAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T73475-Ab | Anti-MMP7/ MMP-7/ MPSL1 functional antibody |
Target Antigen | GM-Tg-g-T73475-Ag | MMP-7/MMP7 protein |
ORF Viral Vector | pGMPC000761 | Human MMP7 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP003953 | Human MMP7 Lentivirus plasmid |
ORF Viral Vector | vGMLP003953 | Human MMP7 Lentivirus particle |
ORF Viral Vector | pGMLV002265 | Human MMP7 Lentivirus plasmid |
Target information
Target ID | GM-T73475 |
Target Name | MMP-7 |
Gene ID | 4316, 17393, 703072, 25335, 727698, 489432, 286794, 100068985 |
Gene Symbol and Synonyms | MAT,Matrilysin,MMP-7,MMP7,MPMM,MPSL1,PUMP-1 |
Uniprot Accession | P09237 |
Uniprot Entry Name | MMP7_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Ovary Cancer, Chronic Kidney Disease |
Gene Ensembl | ENSG00000137673 |
Target Classification | Not Available |
This gene encodes a member of the peptidase M10 family of matrix metalloproteinases (MMPs). Proteins in this family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. The encoded preproprotein is proteolytically processed to generate the mature protease. This secreted protease breaks down proteoglycans, fibronectin, elastin and casein and differs from most MMP family members in that it lacks a conserved C-terminal hemopexin domain. The enzyme is involved in wound healing, and studies in mice suggest that it regulates the activity of defensins in intestinal mucosa. The gene is part of a cluster of MMP genes on chromosome 11. This gene exhibits elevated expression levels in multiple human cancers. [provided by RefSeq, Jan 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.