Human RXRA/NR2B1/ RXR-alpha ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_002957.6)
Pre-made Human RXRA/NR2B1/ RXR-alpha Non-Viral expression plasmid (overexpression vector) for mouse RXRA overexpression in unique cell transient transfection and stable cell line development.
Go
to RXRA/NR2B1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMPC000773 | Human RXRA Mammalian (Non-Viral Vector) plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMPC000773 |
Gene Name | RXRA |
Accession Number | NM_002957.6 |
Gene ID | 6256 |
Species | Human |
Product Type | Mammalian (Non-Viral Vector) plasmid (overexpression) |
Insert Length | 1389 bp |
Gene Alias | NR2B1, RXR-alpha, RXRalpha |
Fluorescent Reporter | |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGACACCAAACATTTCCTGCCGCTCGATTTCTCCACCCAGGTGAACTCCTCCCTCACCTCCCCGACGGGGCGAGGCTCCATGGCTGCCCCCTCGCTGCACCCGTCCCTGGGGCCTGGCATCGGCTCCCCGGGACAGCTGCATTCTCCCATCAGCACCCTGAGCTCCCCCATCAACGGCATGGGCCCGCCTTTCTCGGTCATCAGCTCCCCCATGGGCCCCCACTCCATGTCGGTGCCCACCACACCCACCCTGGGCTTCAGCACTGGCAGCCCCCAGCTCAGCTCACCTATGAACCCCGTCAGCAGCAGCGAGGACATCAAGCCCCCCCTGGGCCTCAATGGCGTCCTCAAGGTCCCCGCCCACCCCTCAGGAAACATGGCTTCCTTCACCAAGCACATCTGCGCCATCTGCGGGGACCGCTCCTCAGGCAAGCACTATGGAGTGTACAGCTGCGAGGGGTGCAAGGGCTTCTTCAAGCGGACGGTGCGCAAGGACCTGACCTACACCTGCCGCGACAACAAGGACTGCCTGATTGACAAGCGGCAGCGGAACCGGTGCCAGTACTGCCGCTACCAGAAGTGCCTGGCCATGGGCATGAAGCGGGAAGCCGTGCAGGAGGAGCGGCAGCGTGGCAAGGACCGGAACGAGAATGAGGTGGAGTCGACCAGCAGCGCCAACGAGGACATGCCGGTGGAGAGGATCCTGGAGGCTGAGCTGGCCGTGGAGCCCAAGACCGAGACCTACGTGGAGGCAAACATGGGGCTGAACCCCAGCTCGCCGAACGACCCTGTCACCAACATTTGCCAAGCAGCCGACAAACAGCTTTTCACCCTGGTGGAGTGGGCCAAGCGGATCCCACACTTCTCAGAGCTGCCCCTGGACGACCAGGTCATCCTGCTGCGGGCAGGCTGGAATGAGCTGCTCATCGCCTCCTTCTCCCACCGCTCCATCGCCGTGAAGGACGGGATCCTCCTGGCCACCGGGCTGCACGTCCACCGGAACAGCGCCCACAGCGCAGGGGTGGGCGCCATCTTTGACAGGGTGCTGACGGAGCTTGTGTCCAAGATGCGGGACATGCAGATGGACAAGACGGAGCTGGGCTGCCTGCGCGCCATCGTCCTCTTTAACCCTGACTCCAAGGGGCTCTCGAACCCGGCCGAGGTGGAGGCGCTGAGGGAGAAGGTCTATGCGTCCTTGGAGGCCTACTGCAAGCACAAGTACCCAGAGCAGCCGGGAAGGTTCGCTAAGCTCTTGCTCCGCCTGCCGGCTCTGCGCTCCATCGGGCTCAAATGCCTGGAACATCTCTTCTTCTTCAAGCTCATCGGGGACACACCCATTGACACCTTCCTTATGGAGATGCTGGAGGCGCCGCACCAAATGACTTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T13726-Ab | Anti-RXRA monoclonal antibody |
Target Antigen | GM-Tg-g-T13726-Ag | RXRA protein |
ORF Viral Vector | pGMPC000773 | Human RXRA Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP001424 | Human RXRA Lentivirus plasmid |
ORF Viral Vector | vGMLP001424 | Human RXRA Lentivirus particle |
Target information
Target ID | GM-T13726 |
Target Name | RXRA |
Gene ID | 6256, 20181, 722068, 25271, 101085757, 491278, 507554, 100069096 |
Gene Symbol and Synonyms | 9530071D11Rik,NR2B1,RXR-alpha,RXRA,RXRalpha,RXRalpha1 |
Uniprot Accession | P19793 |
Uniprot Entry Name | RXRA_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000186350 |
Target Classification | Nuclear Receptors, Tumor-associated antigen (TAA) |
Retinoid X receptors (RXRs) and retinoic acid receptors (RARs) are nuclear receptors that mediate the biological effects of retinoids by their involvement in retinoic acid-mediated gene activation. These receptors function as transcription factors by binding as homodimers or heterodimers to specific sequences in the promoters of target genes. The protein encoded by this gene is a member of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.