Human RXRA/NR2B1 ORF/cDNA clone-Lentivirus particle (NM_002957)

Pre-made Human RXRA/NR2B1 Lentiviral expression plasmid for RXRA lentivirus packaging, RXRA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to RXRA/NR2B1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP001424 Human RXRA Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP001424
Gene Name RXRA
Accession Number NM_002957
Gene ID 6256
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1389 bp
Gene Alias NR2B1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGACACCAAACATTTCCTGCCGCTCGATTTCTCCACCCAGGTGAACTCCTCCCTCACCTCCCCGACGGGGCGAGGCTCCATGGCTGCCCCCTCGCTGCACCCGTCCCTGGGGCCTGGCATCGGCTCCCCGGGACAGCTGCATTCTCCCATCAGCACCCTGAGCTCCCCCATCAACGGCATGGGCCCGCCTTTCTCGGTCATCAGCTCCCCCATGGGCCCCCACTCCATGTCGGTGCCCACCACACCCACCCTGGGCTTCAGCACTGGCAGCCCCCAGCTCAGCTCACCTATGAACCCCGTCAGCAGCAGCGAGGACATCAAGCCCCCCCTGGGCCTCAATGGCGTCCTCAAGGTCCCCGCCCACCCCTCAGGAAACATGGCTTCCTTCACCAAGCACATCTGCGCCATCTGCGGGGACCGCTCCTCAGGCAAGCACTATGGAGTGTACAGCTGCGAGGGGTGCAAGGGCTTCTTCAAGCGGACGGTGCGCAAGGACCTGACCTACACCTGCCGCGACAACAAGGACTGCCTGATTGACAAGCGGCAGCGGAACCGGTGCCAGTACTGCCGCTACCAGAAGTGCCTGGCCATGGGCATGAAGCGGGAAGCCGTGCAGGAGGAGCGGCAGCGTGGCAAGGACCGGAACGAGAATGAGGTGGAGTCGACCAGCAGCGCCAACGAGGACATGCCGGTGGAGAGGATCCTGGAGGCTGAGCTGGCCGTGGAGCCCAAGACCGAGACCTACGTGGAGGCAAACATGGGGCTGAACCCCAGCTCGCCGAACGACCCTGTCACCAACATTTGCCAAGCAGCCGACAAACAGCTTTTCACCCTGGTGGAGTGGGCCAAGCGGATCCCACACTTCTCAGAGCTGCCCCTGGACGACCAGGTCATCCTGCTGCGGGCAGGCTGGAATGAGCTGCTCATCGCCTCCTTCTCCCACCGCTCCATCGCCGTGAAGGACGGGATCCTCCTGGCCACCGGGCTGCACGTCCACCGGAACAGCGCCCACAGCGCAGGGGTGGGCGCCATCTTTGACAGGGTGCTGACGGAGCTTGTGTCCAAGATGCGGGACATGCAGATGGACAAGACGGAGCTGGGCTGCCTGCGCGCCATCGTCCTCTTTAACCCTGACTCCAAGGGGCTCTCGAACCCGGCCGAGGTGGAGGCGCTGAGGGAGAAGGTCTATGCGTCCTTGGAGGCCTACTGCAAGCACAAGTACCCAGAGCAGCCGGGAAGGTTCGCTAAGCTCTTGCTCCGCCTGCCGGCTCTGCGCTCCATCGGGCTCAAATGCCTGGAACATCTCTTCTTCTTCAAGCTCATCGGGGACACACCCATTGACACCTTCCTTATGGAGATGCTGGAGGCGCCGCACCAAATGACTTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T13726-Ab Anti-RXRA monoclonal antibody
    Target Antigen GM-Tg-g-T13726-Ag RXRA protein
    ORF Viral Vector pGMPC000773 Human RXRA Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP001424 Human RXRA Lentivirus plasmid
    ORF Viral Vector vGMLP001424 Human RXRA Lentivirus particle


    Target information

    Target ID GM-T13726
    Target Name RXRA
    Gene ID 6256, 20181, 722068, 25271, 101085757, 491278, 507554, 100069096
    Gene Symbol and Synonyms 9530071D11Rik,NR2B1,RXR-alpha,RXRA,RXRalpha,RXRalpha1
    Uniprot Accession P19793
    Uniprot Entry Name RXRA_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000186350
    Target Classification Nuclear Receptors, Tumor-associated antigen (TAA)

    Retinoid X receptors (RXRs) and retinoic acid receptors (RARs) are nuclear receptors that mediate the biological effects of retinoids by their involvement in retinoic acid-mediated gene activation. These receptors function as transcription factors by binding as homodimers or heterodimers to specific sequences in the promoters of target genes. The protein encoded by this gene is a member of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.