Human PTGES/MGST-IV/ MGST1-L1 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_004878.5)
Pre-made Human PTGES/MGST-IV/ MGST1-L1 Non-Viral expression plasmid (overexpression vector) for mouse PTGES overexpression in unique cell transient transfection and stable cell line development.
Go
to PTGES/MGST-IV products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMPC001111 | Human PTGES Mammalian (Non-Viral Vector) plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMPC001111 |
Gene Name | PTGES |
Accession Number | NM_004878.5 |
Gene ID | 9536 |
Species | Human |
Product Type | Mammalian (Non-Viral Vector) plasmid (overexpression) |
Insert Length | 459 bp |
Gene Alias | MGST-IV, MGST1-L1, MGST1L1, MPGES, mPGES-1, PGES, PIG12, PP102, PP1294, TP53I12 |
Fluorescent Reporter | EGFP |
Mammalian Cell Selection | |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCCTGCCCACAGCCTGGTGATGAGCAGCCCGGCCCTCCCGGCCTTCCTGCTCTGCAGCACGCTGCTGGTCATCAAGATGTACGTGGTGGCCATCATCACGGGCCAAGTGAGGCTGCGGAAGAAGGCCTTTGCCAACCCCGAGGATGCCCTGAGACACGGAGGCCCCCAGTATTGCAGGAGCGACCCCGACGTGGAACGCTGCCTCAGGGCCCACCGGAACGACATGGAGACCATCTACCCCTTCCTTTTCCTGGGCTTCGTCTACTCCTTTCTGGGTCCTAACCCTTTTGTCGCCTGGATGCACTTCCTGGTCTTCCTCGTGGGCCGTGTGGCACACACCGTGGCCTACCTGGGGAAGCTGCGGGCACCCATCCGCTCCGTGACCTACACCCTGGCCCAGCTCCCCTGCGCCTCCATGGCTCTGCAGATCCTCTGGGAAGCGGCCCGCCACCTGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0039-Ab | Anti-PTGES monoclonal antibody |
Target Antigen | GM-Tg-g-IP0039-Ag | PTGES protein |
ORF Viral Vector | pGMPC001111 | Human PTGES Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP000341 | Human PTGES Lentivirus plasmid |
ORF Viral Vector | vGMLP000341 | Human PTGES Lentivirus particle |
Target information
Target ID | GM-IP0039 |
Target Name | PTGES |
Gene ID | 9536, 64292, 716657, 59103, 101086187, 480698, 282019, 100034143 |
Gene Symbol and Synonyms | 2410099E23Rik,D2Ertd369e,MGST-IV,MGST1-L1,MGST1L1,MPGES,mPGES-1,PGES,PIG12,PP102,PP1294,PTGES,TP53I12 |
Uniprot Accession | O14684 |
Uniprot Entry Name | PTGES_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000148344 |
Target Classification | Not Available |
The protein encoded by this gene is a glutathione-dependent prostaglandin E synthase. The expression of this gene has been shown to be induced by proinflammatory cytokine interleukin 1 beta (IL1B). Its expression can also be induced by tumor suppressor protein TP53, and may be involved in TP53 induced apoptosis. Knockout studies in mice suggest that this gene may contribute to the pathogenesis of collagen-induced arthritis and mediate acute pain during inflammatory responses. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.