Human PTGES/MGST-IV/ MGST1-L1 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_004878.5)

Pre-made Human PTGES/MGST-IV/ MGST1-L1 Non-Viral expression plasmid (overexpression vector) for mouse PTGES overexpression in unique cell transient transfection and stable cell line development.

Target products collectionGo to PTGES/MGST-IV products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMPC001111 Human PTGES Mammalian (Non-Viral Vector) plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMPC001111
Gene Name PTGES
Accession Number NM_004878.5
Gene ID 9536
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 459 bp
Gene Alias MGST-IV, MGST1-L1, MGST1L1, MPGES, mPGES-1, PGES, PIG12, PP102, PP1294, TP53I12
Fluorescent Reporter EGFP
Mammalian Cell Selection
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCCTGCCCACAGCCTGGTGATGAGCAGCCCGGCCCTCCCGGCCTTCCTGCTCTGCAGCACGCTGCTGGTCATCAAGATGTACGTGGTGGCCATCATCACGGGCCAAGTGAGGCTGCGGAAGAAGGCCTTTGCCAACCCCGAGGATGCCCTGAGACACGGAGGCCCCCAGTATTGCAGGAGCGACCCCGACGTGGAACGCTGCCTCAGGGCCCACCGGAACGACATGGAGACCATCTACCCCTTCCTTTTCCTGGGCTTCGTCTACTCCTTTCTGGGTCCTAACCCTTTTGTCGCCTGGATGCACTTCCTGGTCTTCCTCGTGGGCCGTGTGGCACACACCGTGGCCTACCTGGGGAAGCTGCGGGCACCCATCCGCTCCGTGACCTACACCCTGGCCCAGCTCCCCTGCGCCTCCATGGCTCTGCAGATCCTCTGGGAAGCGGCCCGCCACCTGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0039-Ab Anti-PTGES monoclonal antibody
    Target Antigen GM-Tg-g-IP0039-Ag PTGES protein
    ORF Viral Vector pGMPC001111 Human PTGES Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP000341 Human PTGES Lentivirus plasmid
    ORF Viral Vector vGMLP000341 Human PTGES Lentivirus particle


    Target information

    Target ID GM-IP0039
    Target Name PTGES
    Gene ID 9536, 64292, 716657, 59103, 101086187, 480698, 282019, 100034143
    Gene Symbol and Synonyms 2410099E23Rik,D2Ertd369e,MGST-IV,MGST1-L1,MGST1L1,MPGES,mPGES-1,PGES,PIG12,PP102,PP1294,PTGES,TP53I12
    Uniprot Accession O14684
    Uniprot Entry Name PTGES_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000148344
    Target Classification Not Available

    The protein encoded by this gene is a glutathione-dependent prostaglandin E synthase. The expression of this gene has been shown to be induced by proinflammatory cytokine interleukin 1 beta (IL1B). Its expression can also be induced by tumor suppressor protein TP53, and may be involved in TP53 induced apoptosis. Knockout studies in mice suggest that this gene may contribute to the pathogenesis of collagen-induced arthritis and mediate acute pain during inflammatory responses. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.